Total RNA was extracted using Trizol reagent (Beyotime, R0016) and the ratio of A260/A280 was examined by a NanoDrop 2000 spectrophotometer (Thermo Scientific). A total of 0.5 ~ 1 µg of purified RNA was reversed-transcribed to cDNA with the BeyoRT™ II First Strand cDNA Synthesis Kit with gDNA Eraser (Beyotime, D7170S) in the following conditions: 65 °C for 5 min, 42 °C for 60 min and 80 °C for 10 min, and then subjected to real-time PCR analysis. Real-time PCR was performed using the BeyoFast™ SYBR Green qPCR Mix (Beyotime, D7260) on an ABI-7900 instrument (Applied Biosystems). The real-time PCR program steps were as follows: 95 °C for 5 min, then 40 cycles of 95 °C for 30 s, 60 °C for 30 s and 72 °C for 30 s. The 2-ΔΔCt method was used to calculate relative mRNA amounts of target genes to the endogenous GAPDH control. The sequences of real-time PCR primers were listed in Table S1 .
Beyort 2 first strand cdna synthesis kit with gdna eraser
Manufactured by Beyotime
Sourced in China
The BeyoRT™ II First Strand cDNA Synthesis Kit with gDNA Eraser is a laboratory equipment product designed for the synthesis of first-strand cDNA from total RNA. The kit includes a gDNA Eraser component to remove genomic DNA contamination prior to cDNA synthesis.
Automatically generated - may contain errors
Lab products found in correlation
Abi 7900 instrument, by Thermo Fisher Scientific (1 mentions)
Beyofast sybr green qpcr mix, by Beyotime (1 mentions)
Trizol reagent, by Beyotime (1 mentions)
One step mirna reverse transcription kit, by HaiGene (1 mentions)
Cfx96 real time detection instrument, by Bio-Rad (1 mentions)
Mirvana mirna isolation kit, by Thermo Fisher Scientific (1 mentions)
Gotaq qpcr master mix, by Promega (1 mentions)
Trizol method, by Beyotime (1 mentions)
Sybr green realtime pcr master mix, by Toyobo (1 mentions)
Quantstudio 7 flex, by Thermo Fisher Scientific (1 mentions)
Beyozol reagent, by Beyotime (1 mentions)
Magzol reagent, by Magen Biotechnology Co (1 mentions)
6 protocols using beyort 2 first strand cdna synthesis kit with gdna eraser
1
Quantitative Real-Time PCR Analysis
2
qPCR Analysis of PDPN and miRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from CAL-27 and CTSC-3 cells using the mirVana miRNA Isolation Kit (Thermo Fisher Scientific). RNA was then reverse-transcribed into complementary DNA (cDNA) using the one-step miRNA reverse transcription kit (HaiGene, China). qPCR was performed with the GoTaq qPCR Master Mix (Promega, Madison, WI, USA). For PDPN, total RNA was extracted from tissues and cells using the RNAeasy spin column-based Animal RNA Isolation Kit (Beyotime, Guangzhou, China). The extracted RNA was then reverse-transcribed using the BeyoRT II First Strand cDNA Synthesis Kit with gDNA Eraser (Beyotime). qPCR was then performed using the BeyoFast SYBR Green qPCR Mix (2 × , High ROX) (Beyotime) in a Bio-Rad CFX96 Real-Time Detection instrument (Bio-Rad, Hercules, CA, USA). GAPDH and U6 were used as reference genes, and the 2−ΔΔCt method was used for quantification. The primer sequences for qPCR are listed in Supplementary Table 2.
3
Quantifying IL-6 mRNA Levels in LPS-Treated RAW 264.7 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To evaluate
the mRNA expression levels of IL-6, total RNA from LPS and SP-, PSP-1-,
and PSP-2-treated RAW 264.7 cells were prepared by the TRIZOL method
(Beyotime, China), according to the manufacturer’s instructions.
cDNA was synthesized with 1 μg of total RNA using the BeyoRT
II First Strand cDNA Synthesis Kit with gDNA Eraser (Beyotime, code
No. D7170M). RT-PCR was carried out using a two-step RT-qPCR system
kit (Takara, China) with the following primer sequences: 5′-TACTCGGCAAACCTAGTGCG-3′
(forward) and 5′-GTGTCCCAACATTCATATTGTCAGT-3′ (reverse)
for mouse IL-6, 5′-TTTGTCAAGCTCATTTCCTGGTATG-3′ (forward)
and 5′-TGGGATAGGGCCTCTCTTGC-3′ (reverse) for mouse Gapdh.
The Gapdh primer was used as an internal control. RT-qPCR was performed
in a 7300 Real-Time PCR Detection System (ABI) with the SYBR Green
Realtime PCR Master Mix (Toyobo, Osaka, Japan) in a 20 μL reaction
volume. The changes in gene expression were determined relative to
that of Gapdh using the 2–ΔΔ Ct method.
the mRNA expression levels of IL-6, total RNA from LPS and SP-, PSP-1-,
and PSP-2-treated RAW 264.7 cells were prepared by the TRIZOL method
(Beyotime, China), according to the manufacturer’s instructions.
cDNA was synthesized with 1 μg of total RNA using the BeyoRT
II First Strand cDNA Synthesis Kit with gDNA Eraser (Beyotime, code
No. D7170M). RT-PCR was carried out using a two-step RT-qPCR system
kit (Takara, China) with the following primer sequences: 5′-TACTCGGCAAACCTAGTGCG-3′
(forward) and 5′-GTGTCCCAACATTCATATTGTCAGT-3′ (reverse)
for mouse IL-6, 5′-TTTGTCAAGCTCATTTCCTGGTATG-3′ (forward)
and 5′-TGGGATAGGGCCTCTCTTGC-3′ (reverse) for mouse Gapdh.
The Gapdh primer was used as an internal control. RT-qPCR was performed
in a 7300 Real-Time PCR Detection System (ABI) with the SYBR Green
Realtime PCR Master Mix (Toyobo, Osaka, Japan) in a 20 μL reaction
volume. The changes in gene expression were determined relative to
that of Gapdh using the 2–ΔΔ Ct method.
4
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After extracting the total RNA of jejunal tissue samples, the first-strand cDNA was synthesized by reverse transcription using BeyoRT II First Strand cDNA Synthesis kit with gDNA Eraser (Beyotime Institute of Biotechnology). The RT-qPCR reactions were conducted in QuantStudio 7 Flex (Applied Biosystems, USA) equipment. The samples in each group had three complex holes, and the specificities of RT-qPCR products were verified by agarose gel electrophoresis followed by melting curve analysis. The relative expression level of each mRNA normalized to glyceraldehyde-3-phosphate dehydrogenase was calculated by the 2−ΔΔCt method (67 (link)). All primers were designed in exon-exon junctions using the Primer-BLAST tool (https://www.ncbi.nlm.nih.gov/tools/primer-blast/ ). The primers used were synthesized by Sangon Biotech (Shanghai, China) and listed in Table S13.
5
Total RNA Extraction and Quantitative PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extraction was carried out using Beyozol Reagent in accordance with the manufacturer’s instructions (Beyotime, Shanghai, China, R0011). Subsequently, genomic DNA was eliminated, and cDNA was synthesized through reverse transcription using the BeyoRT™ II First Strand cDNA Synthesis Kit with gDNA Eraser (Beyotime, D7170M). The primers utilized in this study are detailed in Table 2 , and the HotStart™ Universal 2X SYBR Green qPCR Master Mix (APExBIO, Houston, TX, USA, K1170) was employed. For the RT-qPCR steps, the settings were configured as follows: 95 °C for 2 min (1 cycle); 95 °C for 15 s, 60 °C for 30 s (40 cycles); and 95 °C for 15 s, 60 °C for 60 s, 95 °C for 15 s (1 cycle).
6
Quantification of miR-543 and UBE2T Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MagZol Reagent (Magen, Guangdong, China) was used to extract total RNA. The miRNA 1st Strand cDNA Synthesis Kit (by stem-loop) (Vazyme, China) was used for reverse transcription PCR for miRNA. mRNA reverse transcription was conducted using the BeyoRT™ II First Strand cDNA Synthesis Kit with gDNA Eraser (Beyotime, China). The quantification levels of miR-543 and UBE2T were conducted with GAPDH and U6 as internal controls, respectively, using the 2−ΔΔCt method [18 (link)]. The primers are depicted in Table 1 .
The primers for RT-qPCR for each gene
| Gene name | Primer sequence | |
|---|---|---|
| UBE2T | forward | 5ʹ-CGAGCTCGTAGAAATATTAGGTGGA-3’ |
| reverse | 5ʹ-TCATCAGGGTTGGGTTCTGAC-3’ | |
| miR-543 | forward | 5` – CAGTGCTAAAACATTCGCGG – 3` |
| reverse | 5ʹ-TATGGTTGTTCACGACTCCTTCAC-3’ | |
| GAPDH | forward | 5′-GAGAAGGCTGGGGCTCATTT-3′ |
| reverse | 5′-AGTGATGGCATGGACTGTGG-3′ | |
| U6 | forward | 5′-CGCTTCACGAATTTGCGT-3′ |
| reverse | 5′-CTCGCTTCG CAGCACA-3′ | |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!