Mytaq dna polymerase kit
MyTaq™ DNA Polymerase kit is a high-performance DNA polymerase designed for a wide range of PCR applications. It provides robust amplification with high specificity and sensitivity.
Lab products found in correlation
12 protocols using mytaq dna polymerase kit
Mapping Transgene Insertion in Mutant Mice
5-HTTLPR Genotyping by PCR Analysis
BDNF rs6265 Genotyping Protocol
HCV 5'-UTR Detection by Nested PCR
Leat1 RNA Extraction and RT-PCR
Microbial 16S rRNA gene sequencing
Semiquantitative RT-PCR Analysis of Gene Expression
Genotyping Mice for OVE442 Mutation
Amplifying Barcoding Regions for DNA Analysis
Molecular Characterization of Cuscuta Species
PCR amplification of the ITS region was done using ITS4 and ITS5 primers (Baldwin, 1992) , whereas rbcL was amplified using rbcL-512F and rbcL-1392R primers ( et al., 2007) . Partial amplification of trnL was using trnLF-5'
CGAAATCGGTAGACGCTACG 3' and trnLR-5' ATTTGAACTGGTGACACGAG 3' primers, designed specifically for Cuscuta. PCR reactions were performed in 25 µl volumes using MyTaq™ DNA polymerase kit (Bioline, Meridian Biosciences) under the following conditions; 95°C for 1 minute, followed by 35 cycles comprising 95°C for 15 seconds, each primer's respective annealing temperature for 30 seconds and a 72°C extension for 1 minute. A final 10-minute extension, at 72°C, was also included. PCR products were confirmed on a 1% agarose gel, cleaned using the Qiaquick™ PCR purification kit (Qiagen, USA), and sequenced on the ABI platform at Macrogen (Macrogen. Inc).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!