Nucleospin dna ffpe xs

Genomic DNA was extracted from formalin-fixed paraffin-embedded (FFPE) sections (lung and salivary gland tissues) and feces, using NucleoSpin DNA FFPE XS and NucleoSpin DNA Stool
(MACHEREY-NAGEL, Düren, Germany). PCR reactions (35 to 37 cycles) using primers for the β-actin and RatPyV2 virus protein 1 (VP1) were performed as described previously [15 (link)]. Sequencing of a larger region of VP1 (primer pair F14-R7, 432-bp [15 (link)]) was performed by Macrogen Japan Corp.
(Kyoto, Japan).
For buccal swabs, direct PCR amplification by the Amp-FTA method was conducted [12 ]. Briefly, buccal swabs were collected with 4N6 FLOQSwabs (Copan,
Brescia, Italy) and immediately smeared on the Whatman Indicating FTA Card (GE Healthcare, Little Chalfont, U.K.). Discs (1.5 mm diameter) were punched out from the FTA card by a standard
ear punch and were directly used as templates (one disc for each reaction). PCR reactions (40 cycles) using primers for β-actin and RatPyV2 VP1 [15 (link)]
were performed in Ampdirect Plus buffer (Shimadzu Corp., Kyoto, Japan). As a negative control, we used immunocompetent F344/NSlc strains that were negative for RatPyV2 serological assay, as
conducted by IDEXX BioResearch (Columbia, MO, U.S.A.).

Genomic DNA was extracted from BBN‐induced rat bladder tumors histologically diagnosed as cancer from the control group (n = 10) and the luteolin 100 ppm group (n = 10). The extraction from formalin‐fixed paraffin‐embedded tissues was performed using NucleoSpin DNA FFPEXS (MACHEREY‐NAGEL). Exons 5, 6‐7 and 8 of rat p53 gene were analyzed as previously reported.26 The primer sequences were 5′‐CGCTGACCTTTGATTCTTTC‐3′ and 5′‐AGTTCTAACCCCACAGCAGT‐3′ for exon 5, 5′‐GTTAGAACTGGTTGTCCAGGG‐3′ and 5′‐CCCAACCTGGCACACAGCTTCCT‐3′ for exon 6‐7, and 5′‐CTGTGCTCCTCTTGTCCCG‐3′ and 5′‐CCTCCACCTTCTTTGTCCTG‐3′ for exon 8. PCR products were purified with NucleoSpin Gel and PCR Clean‐up (MACHEREY‐NAGEL). Direct sequencing was performed using 2 µL of aliquots by Applied Biosystems 3130xl Genetic Analyzer (Thermo Fischer Scientific) according to the manufacture’s instructions. Sequencing primers for exon 5 were 5′‐GATTCTTTCTCCTCTCCTACAG‐3′ and 5′‐AGTTCTAACCCCACAGCAGT‐3′, for exon 6‐7 were 5′‐GCCTCTGACTTATTCTTGCT‐3′ and 5′‐AACCTGGCACACAGCTTCCT‐3′, and for exon 8 were 5′‐TGCCTCCTCTTGTCCCGGGT‐3′ and 5′‐CACCTTCTTTGTCCTGCCTG‐3′.