The PCR mix contained 2 μl cDNA, 1 μl of the appropriate forward and reverse primers, and 2 μl SYBR Green PCR Master mix in a total volume of 25 mL. PCR consisted of 50 cycles of denaturation at 94 °C for 30 s, annealing at melting temperature (Tm) for 30 s, and extension at 72 °C for 60 s. Primer sequences for each target gene, their source as well as their optimal PCR annealing temperatures are as follows: GAPDH forward primer 5′-GTGCTGAGTATGTCGTGGAGTCTA-3′ and reverse 5′- TCTCGTGGTTCACACCCATCAC −3′ (Tm 60 °C), and TNF-α forward primer 5′- ACT GAA CTT CGG GGT GAT TG −3′ and reverse 5′- GCT TGG TGG TTT GCT ACG AC −3′ (Tm 60 °C). Primer specificity was confirmed from the product size by agarose gel electrophoresis and the specificity of the PCR products checked by melt curve analysis.
Mj mini opticon real time pcr system
The MJ Mini Opticon Real-Time PCR System is a compact, 48-well thermal cycler designed for real-time PCR analysis. It features a Peltier-based temperature control system and an optical detection system that can monitor fluorescence levels during the amplification process.
Lab products found in correlation
9 protocols using mj mini opticon real time pcr system
Quantitative real-time PCR for gene expression
The PCR mix contained 2 μl cDNA, 1 μl of the appropriate forward and reverse primers, and 2 μl SYBR Green PCR Master mix in a total volume of 25 mL. PCR consisted of 50 cycles of denaturation at 94 °C for 30 s, annealing at melting temperature (Tm) for 30 s, and extension at 72 °C for 60 s. Primer sequences for each target gene, their source as well as their optimal PCR annealing temperatures are as follows: GAPDH forward primer 5′-GTGCTGAGTATGTCGTGGAGTCTA-3′ and reverse 5′- TCTCGTGGTTCACACCCATCAC −3′ (Tm 60 °C), and TNF-α forward primer 5′- ACT GAA CTT CGG GGT GAT TG −3′ and reverse 5′- GCT TGG TGG TTT GCT ACG AC −3′ (Tm 60 °C). Primer specificity was confirmed from the product size by agarose gel electrophoresis and the specificity of the PCR products checked by melt curve analysis.
Profiling Gene Expression in Infected Mice
Impacts of Microbial Inoculation on Wheat Zinc Transporters
RNA Extraction and Gene Expression Analysis
Quantitative Real-Time PCR for Gene Expression Analysis
Quantitative Analysis of BDNF Expression
Quantitative PCR analysis of VIP effects
Quantitative Analysis of DNA Methyltransferases
Mouse GAPDH primer
Sense: 5′-ACAACTTTGGCATTGTGGAA-3′,
Antisense: 5′-GATGCAGGGATGATGTTCTG-3′;
Mouse DNMT1 primer
Sense: 5′-CTGCTGTGGAGAAACTGGAA-3′,
Antisense: 5′-TGATTTCCGCCTCAATGATA-3′;
Mouse DNMT3β primer
Sense: 5′-CTCAAACCCAACAAGAAGCA-3′,
Antisense: 5′-AGCAGCAGAGTCATTGGTTG-3′;
Trp53 primer
Sense: 5′-CTCAGACTGACTGCCTCTGC-3′,
Antisense: 5′-GGCTGAGCCCTAGCTACAAG-3′.
Quantitative RT-PCR Analysis of Berry Transcripts
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!