Transit crispr reagent

CRISPR/Cas9 mediated knockout of Art1 in B16-F10 cells was performed using Sigma-Aldrich custom-made, ready-to-use DNA plasmids on the U6gRNA:CMV-CAS9–2A-tGFP backbone. Two plasmids containing gRNAs targeting regions in exon 3 of the Art1 gene were used to create the B16-F10 clones B16^{ART1KO (63−1)} (sequence 5’−3’: CCTGCGCTTTCGGCCAGCG) and B16^{ART1KO (42−1)} (sequence 5’−3’: CCAACAAAGTATACGCGGA). A negative control plasmid was used to create the B16-F10 clone B16^{CONTROL (Scr−6)} (sequence 5’−3’: CGCGATAGCGCGAATATATT). Briefly, B16-F10 cells were seeded in 12 well-plates and incubated for 48 hours to reach 80% confluency. Each CRISPR plasmid (0.5 μg DNA) were mixed with 3 μl TransIT-CRISPR reagent (Sigma-Aldrich) in 100 μg l Opti-MEM medium (Gibco) and incubated at room temperature for 30 minutes. The mixture was added to the B16-F10 cells and incubated in a humidified 5% CO₂ incubator at 37°C for 24 hours. Flow cytometry activated cell sorting (FACS) was used to sort transfected GFP-positive single cells into flat-bottom 96 well-plates. Clones were expanded and tested for ART1 surface expression by flow cytometry and immunofluorescence staining (fig. S3A and B).