The largest database of trusted experimental protocols

Siport amine reagent

Manufactured by Thermo Fisher Scientific
Sourced in United States

The SiPORT amine reagent is a silane-based reagent that is used to introduce amine functional groups onto the surface of various substrates, such as glass, metal, and ceramic materials. The reagent facilitates the covalent attachment of amine-containing molecules to the treated surfaces, enabling the development of a wide range of applications, including biosensors, affinity chromatography, and surface modification.

Automatically generated - may contain errors

5 protocols using siport amine reagent

1

Endothelial Cell Knockdown Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
siPORT AMINE reagent (AM4503; Ambion) was used to transfect confluent endothelial monolayers with Silencer Select siRNA (Ambion) targeting BAIAP2 (s20463), CLDN5 (s194832), PARD6G (s39149), SORBS2 (s16087), VAV2 (s14755), and VAV3 (s348). Silencer Select negative control number 1 (4390843) was used as nontargeting control. Transfections were performed twice (on days 1 and 3) in 1% FBS DMEM over 4 h with 1 d of recovery in EGM-2 with 5% FBS. Cells were used for experiments 24 h after second knockdown. Knockdown efficiency was assessed by using quantitative PCR.
+ Open protocol
+ Expand
2

Evaluating miRNA-mediated Regulation of 3'UTR Reporters

Check if the same lab product or an alternative is used in the 5 most similar protocols
The HeLa cells were transfected in 12-well plates with the Renilla luciferase-based hTERT 3′UTR reporter constructs using FuGENE HD transfection reagent (Promega, Madison, WI). Transfection efficiency was controlled by co-transfection with a firefly luciferase-based control reporter pCI-firefly [90] (link) and the pEGFP-N1 fluorescent reporter (Clontech Laboratories, Mountain View, CA). After 24 hours the cells were super-transfected with miRNA mimics at 60 nM final concentration using siPORT amine reagent (Ambion). Cells were harvested 72 hours after reporter transfection and analyzed using a Dual-Luciferase Reporter Assay System (Promega). The reporter assay employing constructs with TCF7, MSI1, and PAX5 3′UTR were performed similarly with the following modifications: the HeLa cells were co-transfected in 24-well plates with the Renilla luciferase-based UTR reporter constructs, pCI-firefly, and pEGFP-N1 reporters, and 60 nM miRNA mimics using Metafectene Easy transfection reagent (Biontex-USA). Cells were harvested 48 hours after transfection and analyzed using a Dual-Luciferase Reporter Assay System (Promega). The Renilla luciferase signal of each sample was normalized for differences in transfection efficiency using the activity of co-transfected pCI-firefly reporter as control.
+ Open protocol
+ Expand
3

Transfection of Human Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The Jurkat, HeLa, DLD-1, MCF-7 and Caco-2 cells were the gifts from P. Tucker, C. Sullivan, and J. Dudley (University of Texas, Austin). DLD-1 and Caco-2 colon carcinoma cell lines were described previously [88] (link), [89] (link). The cell lines were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal calf serum (Atlanta Biologicals, Norcross, GA). HeLa, DLD-1, Caco-2, or MCF-7 cells were plated in 6-well (8×104 cells per well) or 12-well plates (4×104 cells per well) and transfected after 24 hours using siPORT amine reagent (Ambion, Austin, TX) or Metafectene SI (Biontex-USA, San Diego, CA) with miRNA mimics (Ambion) at a final concentration of 60 nM (Table S1). All cells (including floating cells) were harvested after 48 hours, counted using a hemocytometer, and cell extracts were prepared for Western blot analysis. Trypan blue staining was used to evaluate the number of dead cells. For TRAP analysis cells were harvested 4 hours after transfection. miRNA inhibitors (Ambion) were electroporated into Jurkat cells under 200 V, 1 µF in siPORT electroporation buffer (Ambion) using Gene Pulser II electroporation apparatus (BioRad).
+ Open protocol
+ Expand
4

siRNA Knockdown of PKCiota in Ovarian Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
siRNA to PKCiota in OVCAR3, IGROV, and SKOV3 was performed using siPORT amine reagent (Ambion, Grand Island, NY) using the reverse transfection protocol according to the manufacturer’s instructions. 2.3 × 105 cells were used per well of 6 well plates. 20nM PKCiota siRNA (gene code 309 and 311) and Silencer Negative Control Number 1 (cat# 4611), both from Ambion were transfected with X-tremeGENE (Genentech, San Francisco, CA), according to the manufacturer’s protocol. To select stable IGROV cells, they were transfected with pRS-shPKCiota (Origene, Rockville, MD #TR320472) using GeneJuice (Millipore) according to the manufacturer’s protocol. shPKCiota 7 sequence TGACCAGAACACAGAGGATTATCTCTTCC targeting exon 14 and and shPKCiota 8 sequence CAGGAGATACAACCAGCACTTTCTGTGGT targeting exon 13 were determined to target only a single sequence. shControl (shRNA 3; CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG) was the control, not specific for PKCiota. Stable clones were selected using 1 μg/mL Puromycin. OVCA420 cells were transfected with pcDNA3.1 constructs containing sequences coding for full-length cyclin E (EL) or the LMW-E forms (T1 and T2) using fuGENE 6 (Roche) according to the manufacturer’s instructions.
+ Open protocol
+ Expand
5

siRNA Knockdown of PKCiota in Ovarian Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
siRNA to PKCiota in OVCAR3, IGROV, and SKOV3 was performed using siPORT amine reagent (Ambion, Grand Island, NY) using the reverse transfection protocol according to the manufacturer’s instructions. 2.3 × 105 cells were used per well of 6 well plates. 20nM PKCiota siRNA (gene code 309 and 311) and Silencer Negative Control Number 1 (cat# 4611), both from Ambion were transfected with X-tremeGENE (Genentech, San Francisco, CA), according to the manufacturer’s protocol. To select stable IGROV cells, they were transfected with pRS-shPKCiota (Origene, Rockville, MD #TR320472) using GeneJuice (Millipore) according to the manufacturer’s protocol. shPKCiota 7 sequence TGACCAGAACACAGAGGATTATCTCTTCC targeting exon 14 and and shPKCiota 8 sequence CAGGAGATACAACCAGCACTTTCTGTGGT targeting exon 13 were determined to target only a single sequence. shControl (shRNA 3; CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG) was the control, not specific for PKCiota. Stable clones were selected using 1 μg/mL Puromycin. OVCA420 cells were transfected with pcDNA3.1 constructs containing sequences coding for full-length cyclin E (EL) or the LMW-E forms (T1 and T2) using fuGENE 6 (Roche) according to the manufacturer’s instructions.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!