The SARS‐CoV‐2 pseudovirus was prepared as previously described.34 Briefly, the SARS‐CoV‐2 spike pseudovirus and the SARS‐CoV‐2 Delta strain spike pseudovirus were prepared by transfecting the plasmid pcDNA3.1‐SARS2‐Spike (Addgene #145032) or plasmid pcDNA3.3‐SARS‐B.1.617.2 Spike (Addgene #172320), respectively, together with plasmids pMDL, pREV, and pHIV7‐eGFP‐ffLuc into HEK293T cells. The authentic SARS‐CoV‐2 (Isolate USA‐WA1/2020) and SARS‐CoV‐2 Delta strain (Isolate hCoV‐19/USA/MD‐HP05647/2021, Lineage B.1.617.2) was prepared as previous described.4 , 40 , 41 The SARS‐CoV‐2 Omicron variant (NR‐56475, Isolate hCoV‐19/USA/HI‐CDC‐4359259‐001/2021) used in this study was obtained through BEI Resources. The following reagent was deposited by the Centers for Disease Control and Prevention and obtained through BEI Resources, NIAID, NIH: SARS‐Related Coronavirus 2, Isolate USA‐WA1/2020, NR‐52281.
Isolate usa wa1 2020
Manufactured by BEI Resources
Sourced in United States
The Isolate USA-WA1/2020 is a laboratory equipment product. It is primarily used for isolating and extracting samples. The core function of this product is to facilitate the separation and purification of specific components from complex mixtures.
Automatically generated - may contain errors
Lab products found in correlation
Vero e6 cell, by American Type Culture Collection (2 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (2 mentions)
Fetal bovine serum (fbs), by Atlas Biologicals (2 mentions)
Nr 52286, by BEI Resources (2 mentions)
Ambion rna storage solution, by Thermo Fisher Scientific (1 mentions)
Steponeplus platform, by Thermo Fisher Scientific (1 mentions)
Vero e6, by American Type Culture Collection (1 mentions)
Rnase inhibitor, by New England Biolabs (1 mentions)
Nr 52287, by BEI Resources (1 mentions)
Vr 740, by American Type Culture Collection (1 mentions)
Vr 1558, by American Type Culture Collection (1 mentions)
2019 ncov cdc eua kit, by Integrated DNA Technologies (1 mentions)
Ultraplex 1 step toughmix 4x, by Quantabio (1 mentions)
20 protocols using isolate usa wa1 2020
1
SARS-CoV-2 Pseudovirus and Authentic Virus Preparation
2
SARS-CoV-2 Genome Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We tested purified genomic RNA from a reference strain of SARS-CoV-2, isolate USA-WA1/2020 (BEI Resources, Manassas, VA) to generate standard curves for the CDC COV and ACOV assays in order to estimate the concentration of SARS-CoV-2 genome equivalents in nasopharyngeal swab samples. We serially diluted the standard and tested extraction and amplification on both assays independently in triplicate. The IDNOW assay does not provide CT values to the user, so we could not generate a standard curve for this system.
3
SARS-CoV-2 Propagation in VERO E6 Cells
4
SARS-CoV-2 Isolation and Compound Testing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The clinical isolate of SARS-CoV-2 (SARS-CoV-2, Isolate USA-WA1/2020) was obtained from BEI Resources and manipulated in BSL3 containment at University of Illinois at Chicago (Chicago, IL). Compounds CHLA and PUG were purchased from MedChemExpress (MCE; Monmouth Junction, NJ, USA). The fluorescence resonance energy transfer (FRET)-based peptidic substrate (Dabcyl-KTSAVLQ/SGFRKME-Edans) was purchased from NJpeptide (Nanjing, China).
5
SARS-CoV-2 Nucleocapsid Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA coding sequences
corresponding to SARS-CoV-2 NP were amplified from genomic RNA from
SARS-CoV-2, isolate USA-WA1/2020 (BEI Resources, catalog no. NR-52285)
using primer sets 5SacINP (5′- CACTGAGCTCATGTTTGTTTTTCTTGTTTTATTG-3′)
and 3SmaINP (3′- CACTCCCGGGTGTGTAATGTAATTTGACTCCTTT-5′).
PCR fragments were digested with SacI and SmaI and cloned into SacI-
and SmaI-digested pCAGGS plasmid containing a C-terminal HA epitope
tag (pCAGGS NP-HA).
20 μL of 15,000 Vero E6 cells per
well was seeded into half-area 96-well plates and incubated O/N at
37 °C, 5% CO2. A plasmid encoding for SARS-CoV-2 NP
(pCAGGS NP-HA) was transfected into the cells using Lipofectamine
2000 according to manufacturer’s recommendations (starting
concentration 100 ng of plasmid and twofold serial dilutions). Cells
were incubated with plasmid and Lipofectamine 2000 for 4-6h before
replacing media with DMEM containing 2% FBS. Cells were incubated
O/N at 37 °C, 5% CO2 to express NP in a volume of
20 μL. After 24 h, 10 μL of 3× HTRF reagents diluted
in 1.5% Triton X-100 with PI were added to cells and incubated for
1 h at RT or O/N at 4 °C. The TR-FRET ratio was measured at the
end of each incubation time.
corresponding to SARS-CoV-2 NP were amplified from genomic RNA from
SARS-CoV-2, isolate USA-WA1/2020 (BEI Resources, catalog no. NR-52285)
using primer sets 5SacINP (5′- CACTGAGCTCATGTTTGTTTTTCTTGTTTTATTG-3′)
and 3SmaINP (3′- CACTCCCGGGTGTGTAATGTAATTTGACTCCTTT-5′).
PCR fragments were digested with SacI and SmaI and cloned into SacI-
and SmaI-digested pCAGGS plasmid containing a C-terminal HA epitope
tag (pCAGGS NP-HA).
20 μL of 15,000 Vero E6 cells per
well was seeded into half-area 96-well plates and incubated O/N at
37 °C, 5% CO2. A plasmid encoding for SARS-CoV-2 NP
(pCAGGS NP-HA) was transfected into the cells using Lipofectamine
2000 according to manufacturer’s recommendations (starting
concentration 100 ng of plasmid and twofold serial dilutions). Cells
were incubated with plasmid and Lipofectamine 2000 for 4-6h before
replacing media with DMEM containing 2% FBS. Cells were incubated
O/N at 37 °C, 5% CO2 to express NP in a volume of
20 μL. After 24 h, 10 μL of 3× HTRF reagents diluted
in 1.5% Triton X-100 with PI were added to cells and incubated for
1 h at RT or O/N at 4 °C. The TR-FRET ratio was measured at the
end of each incubation time.
6
SARS-CoV-2 Virus Isolation and Titration
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SARS-CoV-2 coronavirus (Isolate USA-WA1/2020) was obtained from BEI Resources. Stocks of virus were grown in Vero-E6 cells in DMEM (Gibco) supplemented with 10% fetal bovine serum (Atlas Biologicals) and 25mM HEPES (pH 7.5) in BSL-3+ containment at the Colorado State University Regional Containment Biocontainment Laboratory. Virus containing media was stored at −80°C in single use aliquots. Viral titers were performed using plaque assay as described (28 (link)).
7
Determination of SARS-CoV-2 Assay LOD
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Limit of detection (LOD) was determined by extracting and testing serial dilutions of quantified inactivated SARS-CoV-2 from Isolate USA-WA1/2020 (NR-52287, BEI Resources, Manassas, VA). SARS-CoV-2 viral material was provided at a concentration of 4.1 × 109 genome equivalents (GE)/mL, from which the following serial dilutions were prepared in GE/mL: 4000, 2000, 1000, 500, 250, and 125. Ambion RNA Storage Solution (catalog number AM7001; Thermo Fisher Scientific) was used to prevent the potential RNA degradation, and replicates ranging from 4 to 10 at each dilution went through nucleic acid extraction on different days and were tested on both the modified CDC assay and the NWHL LDT. LOD was defined as the concentration of the lowest dilution that can be detected with >95% probability and was determined by using probit analysis.
8
SARS-CoV-2 Detection via RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples were vortexed, and 50 μL was aliquoted for MagPlate OMEGA extraction following manufacturer protocols. RNA was tested by semiquantitative real time RT-PCR on the StepOnePlus platform (ABI) with qScript XLT 1-Step RT-PCR ToughMix, using five primer sets: one for internal controls (ACTB) and three for SARS-CoV-2 (ORF1b, N1, RdRP). CoVERS-ACTB, Forward: GATGCAGAAGGAGATCAC, Reverse: CTAGAAGCATTTGCGGTG, Probe: HEX-CTCCTGCTTGCTGATCCACA-TAM; HKU-ORF1, Forward: TGGGGYTTTACRGGTAACCT, Reverse: AACRCGCTTAACAAAGCACTC, Probe: FAM-TAGTTGTGATGCWATCATGACTAG-TAM; 2019-nCoV_N1 [CDC], Forward: GACCCCAAAATCAGCGAAT, Reverse: TCTGGTACTGCAGTTGAATCTG, Probe: FAM-ACCCCGCATTACGTTTGGTGGACC-TAM; RdRP_SARSr, Forward: GTGARATGGTCATGTGTGGCmGG, Reverse: CARATGTTAAASACACTATTAGCAmTA, Probe: FAM-CAGGTGGAACCTCATCAGGAGATGC-TAM. All plates were run with negative viral transport medium (VTM) controls and positive control (NR-52285, Genomic RNA from SARS-Related Coronavirus 2, Isolate USA-WA1/2020, BEI Resources).
9
Microglia Responses to SARS-CoV-2 Spike Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human Microglia (HMC3) were obtained from ATCC (Cat # ATCC® CRL-3304™) and grown in Eagle's Minimum Essential Medium (EMEM) (Cat #ATCC® 30–2003™) supplemented with 5% fetal bovine serum (FBS), 100 U/ml penicillin, and 100 μg/ml streptomycin. Cultures were maintained at 370C in a humidified 5% CO2 in air incubator. We treated human microglia (HMC3 -ATCC) with (0.5 µg/ml) of recombinant spike protein from SARS-COV2, Wuhan-Hu-1 (Cat # NR-52308; Lot: 70,034,410 BEI resources Inc) which is described as a recombinant form of the spike (S) glycoprotein from SARS-COV2, Wuhan-Hu-1 (GenPept: QJE37812) which was produced by transfection of purified plasmid in SF9 insect cells using a baculovirus expression system and purified by nickel affinity chromatography or 5 µl/ml of heat inactivated SARS-COV2, Isolate USA-WA1/2020, (Cat # NR-52286, Lot: 70,033,548; Pre-Inactivation Titer by TCID50 Assay in Vero E6 Cells = 1.6 × 105 TCID50 per mL, BEI resources Inc) for 24–48 h followed by cell viability assays, gene expression analyses, quantitation of mitochondrial respiration, ROS quantitation. The Raman spectroscopic analysis for these cells was done at an 3 h time point, post treatment which enables examining early changes in SARS-COV2 induced cell apoptosis.
10
SARS-CoV-2 Propagation and Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All work with SARS-CoV-2 was conducted in Biosafety Level-3 conditions at the University of California San Diego following the guidelines approved by the Institutional Biosafety Committee. SARS-CoV-2 isolate USA-WA1/2020 (BEI Resources) was propagated and infectious units quantified by plaque assay using Vero E6 (ATCC) cells. See the infection details in Supplementary Note .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!