Plasma total RNA was extracted using Trizol Kit (Invitrogen, CA) according to the manufacturer’s instructions. The absorbance of the extract at 260 and 280 nm was determined by Ultraviolet spectrophotometry. The ratio between 1.7 and 2.1 indicated that the sample had high purity and could be used for further research. RNA was reverse transcribed into cDNA using a reverse transcription kit (Yiqiao Shenzhou Technology Co., Ltd, Beijing, China). qRT-PCR used an ABI 7500 quantitative PCR system (Thermo Fisher Scientific, Waltham, MA). β-actin was used as an internal reference. The primer sequence of miR-145 was: Forward: 5’-GCCTCCCTGAGACCCTTTA-3’, Reverse: 5’- GTGTCGTGGAGTCGCA-3’. The primer sequence of β-actin was Forward: 5’-AGGCACTGGGCTTCATCTGAC-3’, Reverse: 5’- GCCTTCCATCCTTGCTTAG-3’. PCR reaction conditions: Pre denaturation at 95 °C for 1 minute; denaturation at 95 °C for 5 seconds, anneal at 60 °C for 10 seconds, extension at 72 °C for 15 seconds (collect fluorescence), and repeating 40 cycles. The amplified products were electrophoresed. The absorbance of miR-145 and β-actin was obtained by Ultraviolet spectrophotometry. The absorbance of β-actin as the reference, calculated the change value of absorbance of miR-145 (ΔCT), and the relative expression of miR-145 was obtained by 2-ΔCT.
Abi7500 quantitative pcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The ABI7500 quantitative PCR system is a real-time PCR instrument designed for gene expression analysis and genetic variation detection. It utilizes fluorescence-based detection technology to quantify target nucleic acid sequences in a sample.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (6 mentions)
Sybr green pcr master mix, by Roche (2 mentions)
Primescript rt master mix kit, by Takara Bio (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Easypure rna kit, by Transgene (2 mentions)
Trizol kit, by Thermo Fisher Scientific (1 mentions)
Ultrasybr mixture, by CWBIO (1 mentions)
Rna extraction kit, by Beyotime (1 mentions)
Rnaiso plus reagent, by Takara Bio (1 mentions)
Taq pro universal sybr qpcr master mix, by Vazyme (1 mentions)
Hiscript 3 first strand cdna synthesis kit, by Vazyme (1 mentions)
Chromas lite, by Technelysium (1 mentions)
Gdna remover kit, by Toyobo (1 mentions)
Sybr green pcr kit, by Takara Bio (1 mentions)
Reverse transcription reaction kit, by Takara Bio (1 mentions)
Total rna extraction reagent, by Promega (1 mentions)
Recoverall total nucleic acid isolation kit, by Thermo Fisher Scientific (1 mentions)
Taqman mirna rt kit, by Thermo Fisher Scientific (1 mentions)
Sds version 2, by Thermo Fisher Scientific (1 mentions)
Taqman microrna assay, by Thermo Fisher Scientific (1 mentions)
18 protocols using abi7500 quantitative pcr system
2
Quantifying Gene Expression in Pancreatic Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The whole RNA from pancreatic epithelial cells (HPDE6-C7) and pancreatic cancer cells (ASPC-1, BXPC-3, SW 1990) was extracted using an RNA Extraction Kit (Beyotime) and subsequently reverse transcribed into cDNA. Amplification reactions were performed with ABI7500 quantitative PCR system (Thermofisher) using UltraSYBR Mixture according to the manufacturer’s manual (Cwbio). The 2−ΔΔCT approach was used to compute the relative expression levels of genes, which were measured in triplicate. GAPDH serves as a reference by which to compare the relative gene expression levels. Primers are listed in the Supplementary Table S2 , which were designed by Primer Bank (https://pga.mgh.harvard.edu/primerbank/index.html ).
3
Isolation and Quantification of RNA for qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol® reagent (Thermo Fisher Scientific) was utilized in order to isolate total RNA as per the manufacturer’s instructions. Spectrophotometry (Thermo Fisher Scientific) was applied to quantify the isolated RNA using 260/280 nanometer absorbance. RNA specimens were preserved at -80°C. An ABI 7500 quantitative PCR System (Thermo Fisher Scientific) was applied to perform and analyze quantitative reverse transcriptase PCR (qRT-PCR). Relative mRNA expression was assessed according to the comparative cycle threshold (CT) (2−ΔΔCT) approach. GAPDH served as the internal reference for normalization. Primers used in this study are as follows: SIRT1 forward: ATGAAGCAC CAACCGTATC, reverse: CTGAATTGACCTTGACT GATG; GADPH forward: GTCTCCTCTGACTTCAA CAGCG, reverse: ACCACCCTGTTGCTGTAGCCAA; iNOS forward: AATGGCAACATCAGGTCGGCCATCACT, reverse: GCTGTGTGTCACAGAAGTCTCGAACTC; TNF-α forward: CATCTTCTCAAAATTCGAGTGACAA, reverse: TGGGAGTAGACAAGGTACAACCC; IL-1β forward: TCATTGTGGCTGTGGAGAAG, reverse: AGGCCA CAGGTATTTTGTCG; IL-6 forward: ATCCAGTTGC CTTCTTCTTGGGACTGA, reverse: TAAGCCTCCGAC TTGTGAAGTGGT.
4
Quantitative Real-Time PCR Analysis of RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from transfected HUVECs using TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc.). The PrimeScript RT Master Mix kit (Takara Biotechnology, Co., Ltd.) was utilized to synthesize cDNA according to the manufacturer's instructions. Subsequently, qPCR was performed with SYBR-Green PCR Master mix (Roche Diagnostics) on an ABI quantitative PCR 7500 system (Applied Biosystems; Thermo Fisher Scientific, Inc.). Thermocycling conditions were as follows: 95°C for 10 min, followed by 40 cycles at 95°C for 15 sec and 60°C for 60 sec. At the end of the reaction, the melting curve was analyzed. Relative gene expression was normalized to β-actin, and the associated data were normalized using the 2−∆∆Cq method (18 (link)). The primer sequences are listed in Table SII .
5
RT-qPCR Analysis of Salusin-β and HO-1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-qPCR was used to analyze the expression of genes. Total RNA was isolated from cells using TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc.). The PrimeScript RT Master Mix kit (Takara Biotechnology, Co., Ltd.) was utilized to synthesize cDNA according to the manufacturer's instructions. Subsequently, qPCR was performed with SYBR-Green PCR Master Mix (Roche Diagnostics) on an ABI Quantitative PCR 7500 system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The primers used were as follows: Salusin-β forward, 5′-TCACTTCTCTCCTATCATCCACTCC-3′ and reverse, 5′-GGCAGCTTGTCCATCTCATCG-3′; HO-1 forward, 5′-GTCCCAGGATTTGTCCGAGG-3′ and reverse, 5′-GGAGGCCATCACCAGCTTAAA-3′; and GAPDH forward, 5′-GTGGAGTCTACTGGCGTCTT-3′ and reverse, 5′-TGCTGACAATCTTGAGGGA-3′. PCR reaction conditions were as follows: 95°C for 2 min, followed by 40 cycles of 95°C for 20 sec and 65°C for 40 sec. Expression levels of target genes were normalized to endogenous control GAPDH using the 2−ΔΔCq method (24 (link)).
6
Quantitative PCR Analysis of RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After the total RNA was extracted from BV2 cells, primary microglial cells or tissues using RNAiso Plus reagent (Takara, Tokyo, Japan), the total RNA (500 ng) was reverse transcribed into cDNA using HiScript III first Strand cDNA Synthesis Kit (Vazyme, Nanjing, China). Real-Time Quantitative PCR was carried out using Taq Pro universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) and ABI-7500 quantitative PCR system (Applied Biosystems, Warrington, United Kingdom). The sequence of PCR primers was shown in Table 2 (Gu et al., 2018 (link)).
7
Quantitative Analysis of SYNPO2 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to the manufacturer’s instructions (Thermo Fisher Scientific), total RNA was extracted using TRIzol® reagent. The isolated RNA was measured at 260/280 nm using spectrophotometry (Thermo Fisher Scientific). RNA samples were stored at −80°C. Real-time reactions were run and analyzed by using the ABI 7500 quantitative PCR System (Applied Biosystems, Foster City, CA, USA). The relative expression of mRNA was calculated using the comparative cycle threshold (CT) (2−ΔΔCT) method with GAPDH as the endogenous control to normalize the data. The sequences of the primers used were as follows:
SYNPO2 forward: 5′-ATGAAGCACCAACCGTATC-3′ and reverse: 5′-CTGAATTGACCTTGACTGATG-3′; GADPH forward: 5′-GTCTCCTCTGACTTCAACAGCG-3′ and reverse: 5′-ACCACCCTGTTGCTGTAGCCAA-3′.
SYNPO2 forward: 5′-ATGAAGCACCAACCGTATC-3′ and reverse: 5′-CTGAATTGACCTTGACTGATG-3′; GADPH forward: 5′-GTCTCCTCTGACTTCAACAGCG-3′ and reverse: 5′-ACCACCCTGTTGCTGTAGCCAA-3′.
8
RNA Isolation and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA (10 μg/sample) was isolated and used to synthesize cDNA as described previously (13 (link)). The xfeA transcript in cDNA samples was sequenced using the c T408 F/R primers (Table S2). The sequencing chromatograms were analyzed with Chromas Lite (Technelysium, Brisbane, Australia), and the frequency of editing was estimated by ratiometric A/G measurement as described (13 (link)).
The EasyPure RNA kit was used to purify RNA as recommended (TransGen Biotech), and 1 μg of RNA was used to synthesize cDNA with the Magic 1st cDNA synthesis kit (Magic Biotech, Hangzhou, China). The cDNA product (20 μl) was diluted to 100 μl and used for qRT‐PCR with Magic SYBR green qPCR mix (Magic Biotech) and the ABI 7500 quantitative PCR system (Applied Biosystems, Foster City, CA). Expression was normalized with rpoD using the ΔΔCT method as described (13 (link)). Experiments included three independent biological replicates.
The EasyPure RNA kit was used to purify RNA as recommended (TransGen Biotech), and 1 μg of RNA was used to synthesize cDNA with the Magic 1st cDNA synthesis kit (Magic Biotech, Hangzhou, China). The cDNA product (20 μl) was diluted to 100 μl and used for qRT‐PCR with Magic SYBR green qPCR mix (Magic Biotech) and the ABI 7500 quantitative PCR system (Applied Biosystems, Foster City, CA). Expression was normalized with rpoD using the ΔΔCT method as described (13 (link)). Experiments included three independent biological replicates.
9
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA content was extracted from hippocampal tissues and cells using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA). RNA concentration and purity were subsequently determined with a Nanodrop 2000 micro-ultraviolet spectrophotometer (1011U, Thermo, Waltham, MA, USA). Next, the obtained RNA was reverse-transcribed into cDNA using Reverstra Ace® qPCR RT Master Mix with a gDNA Remover kit (Toyobo, Osaka, Japan). Primers for KLF2, Caspase-3, Bax, IRF4, and HDAC7 were designed and synthesized by TaKaRa (Dalian, China) (Table S1 ). Real-time quantitative PCR was then performed with an ABI7500 quantitative PCR system (Applied Biosystems, Foster City, CA, USA. The reaction conditions were as follows: pre-denaturation at 95 °C for 10 min, denaturation at 95 °C for 10 s, annealing at 60 °C for 20 s, extension at 72 °C for 34 s, for a total of 40 cycles. β-actin was used as the internal reference, and relative quantification of the target was calculated using the 2-ΔΔCT method. Each experiment was repeated three times independently to obtain the mean value.
10
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues or cells utilizing total RNA extraction reagent (Promega, Madison, Wisconsin, USA), which was then reverse transcribed into cDNA via reverse transcription reaction kit Takara, Japan). qRT-PCR was presented via ABI7500 quantitative PCR system (Applied Biosystems, Warring ton, UK) and SYBR Green PCR Kit (Takara). Relative expression levels were determined with the 2-ΔΔCt method 8 (link). Primers were designed and synthesized by Sangon Biotech (Shanghai, China). Primer sequences were as follows: ZFPM2-AS1: 5'-CAATGGGACTAAGCCAGGCA-3' (forward), 5'-GGGCTCCACCAACAACCATA-3' (reverse); miR-515-5p: 5'-TTCTCCAAAAGAAAGCACTTTCTG-3'; TUSC3: 5'-GGCTCAGTTTGTGGCAGAATC-3' (forward), 5'-CATCGCCTTTCGAAGTTGCT-3' (reverse); GAPDH: 5'-GTCAACGGATTTGGTCTGTATT-3' (forward), 5'-AGTCTTCTGGGTGGCAGTGAT-3' (reverse).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!