Pfu ultra 2 hotstart 2x master mix

Manufactured by Agilent Technologies

Pfu Ultra II Hotstart 2X Master Mix is a pre-mixed solution containing Pfu Ultra II DNA polymerase, dNTPs, and required buffer components. It is designed for high-fidelity PCR amplification.

Automatically generated - may contain errors

Lab products found in correlation

Chicken serum, by Thermo Fisher Scientific (1 mentions) Hemin, by Merck Group (1 mentions) Primerscript first strand cdna synthesis kit, by Takara Bio (1 mentions) Dylight 800cw secondary antibodies, by Thermo Fisher Scientific (1 mentions) Protein a g plus agarose, by Santa Cruz Biotechnology (1 mentions) β mercaptoethanol, by Thermo Fisher Scientific (1 mentions) Rpmi 1640 media, by Thermo Fisher Scientific (1 mentions) Anti flag m2 monoclonal antibody, by Merck Group (1 mentions) Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions) Kh2po4, by Merck Group (1 mentions) Folic acid, by Merck Group (1 mentions) Na2hpo4, by Merck Group (1 mentions) Fetal bovine serum (fbs), by Gemini Bio (1 mentions) Ha 11 monoclonal antibody, by Fortrea (1 mentions) Restriction enzyme, by New England Biolabs (1 mentions) Quikchange lightning site directed mutagenesis kit, by Agilent Technologies (1 mentions) Zero blunt topo cloning kit, by Thermo Fisher Scientific (1 mentions) Zymo clean and concentrator kit, by Zymo Research (1 mentions)

5 protocols using pfu ultra 2 hotstart 2x master mix

Molecular Cloning Protocol Compendium

Check if the same lab product or an alternative is used in the 5 most similar protocols

Restriction enzymes were from New England Biolabs. Pfu Ultra II Hotstart 2X Master Mix was from Agilent. PrimerScript First Strand cDNA synthesis kit was from TaKaRa. Clone ID 1X Colony PCR Master Mix was from Lucigen. Peptone was obtained from Bacto. Yeast extract was from BD Transduction laboratories. KH₂PO₄, Na₂HPO₄, yeast nucleic acid, folic acid, hemin and Monoclonal anti-Flag M2 antibody were from Sigma. HA.11 monoclonal antibody was purchased from Covance. Fetal bovine serum was from Gemini Bio-products. T4 ligase and Dylight^™ 700CW and Dylight^™800CW secondary antibodies were from Thermo Scientific. Protein A/G Plus-agarose was from Santa Cruz Biotechnology. DMEM (Dulbecco’s modified Eagle medium), RPMI 1640 media, chicken serum, beta mercaptoethanol and G418 sulfate and Trizol were from Invitrogen. Reagents used for SDS-PAGE were purchased from Bio-Rad.

Alzayady K.J., Sebé-Pedrós A., Chandrasekhar R., Wang L., Ruiz-Trillo I, & Yule D.I. (2015). Tracing the Evolutionary History of Inositol, 1, 4, 5-Trisphosphate Receptor: Insights from Analyses of Capsaspora owczarzaki Ca2+ Release Channel Orthologs. Molecular Biology and Evolution, 32(9), 2236-2253.

+ Open protocol

+ Expand

Site-Directed Mutagenesis of IP3 Receptors

Check if the same lab product or an alternative is used in the 5 most similar protocols

Substitutions to amino acids D, A, or Q at the desired site/residue in rIP₃R3, hIP₃R3, and hIP₃R1 were generated using Pfu Ultra II Hotstart 2X Master Mix (Agilent Technologies) and appropriate primers obtained from Integrated DNA Technologies (SI Appendix, Table S1). A QuikChange Lightning site–directed mutagenesis kit (Agilent Technologies #210518) was used to introduce the desired substitution in cDNAs encoding the rIP₃R3 (NP_037270), hIP₃R3 (NP_002215.2), and hIP₃R1 (NP_001093422.2) in pDNA3.1 expression plasmid using mutagenic primers. The introduction of desired substitution and coding regions for all of the constructs was confirmed by Sanger sequencing.

Arige V., Terry L.E., Wagner LE I.I., Malik S., Baker M.R., Fan G., Joseph S.K., Serysheva I.I, & Yule D.I. (2022). Functional determination of calcium-binding sites required for the activation of inositol 1,4,5-trisphosphate receptors. Proceedings of the National Academy of Sciences of the United States of America, 119(39), e2209267119.

+ Open protocol

+ Expand

Introducing Amino Acid Substitutions in hIP3R1

Check if the same lab product or an alternative is used in the 5 most similar protocols

A two-step QuikChange mutagenesis protocol was used to introduce amino acid substitutions into cDNA encoding the human IP₃R1 (hIP₃R1; NM_001099952 in pDNA3.1 (Obtained from Annetta Wronska at Columbia University)). Mutagenesis and all DNA modifications were carried out using Pfu Ultra II Hotstart 2X Master Mix (Agilent). Mutagenesis primers for hIP₃R1 F2586K forward (TCTTCATGGTCATCATCATTGTTCTTAACCTGATTAAGGGGGTTATCATTGACACT), hIP₃R1 F2586K reverse (AGTGTCAATGATAACCCCCTTAATCAGGTTAAGAACAATGATGATGACCATGAAGA), hIP₃R1 I2590N forward (TTGGGGTTATCAATGACACTTTTGCTGACCTACGTAGTGAGAAGCAG), hIP₃R1 I2590N reverse (CTGCTTCTCACTACGTAGGTCAGCAAAAGTGTCATTGATAACCCCAA), hIP₃R1 I2590T forward (TTGGGGTTATCACTGACACTTTTGCTGACCTACGTAGTGAGAAGCAG), and hIP₃R1 I2590T reverse (CTGCTTCTCACTACGTAGGTCAGCAAAAGTGTCAGTGATAACCCCAA), were synthesized by Integrated DNA Technologies (IDT). In addition to encoding the specified mutations, primers also silently introduced a restriction site for verification purposes. The coding regions for all constructs were confirmed by sequencing.

Fan G., Baker M.R., Terry L.E., Arige V., Chen M., Seryshev A.B., Baker M.L., Ludtke S.J., Yule D.I, & Serysheva I.I. (2022). Conformational motions and ligand-binding underlying gating and regulation in IP3R channel. Nature Communications, 13, 6942.

+ Open protocol

+ Expand

Cas9-Mediated Genome Editing Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plant and bacterial DNA were extracted as previously published [29 (link)]. Forward and reverse primers were designed to anneal to genomic DNA sequences at approximately 250 bp flanking the putative clipping sites (S2 Table). PCR was performed using PfuUltra II Hotstart 2X Master Mix (Agilent Technologies, Inc). After amplification the PCR products were purified using the Zymo Clean and Concentrator Kit (Zymoresearch, USA). For direct sequencing of PCR products, the same primer set for amplifications were used. For sequencing of cloned PCR products, PCR fragments were cloned directly into pCR2.1 using the manufacturer’s recommendations for the Zero Blunt Topo cloning kit (Life Technologies), and sequenced using M13F and M13R primers. In both cases DNA traces were compared to wild type sequences using the SeqMan function from LaserGene analysis package. For directly sequenced PCR products, deviations from a consensus trace that originated near the -3 position relative to the NGG PAM site, the known site of Cas9 cutting, were scored as evidence of genome editing in somatic tissues relative to wild type traces.

Peterson B.A., Haak D.C., Nishimura M.T., Teixeira P.J., James S.R., Dangl J.L, & Nimchuk Z.L. (2016). Genome-Wide Assessment of Efficiency and Specificity in CRISPR/Cas9 Mediated Multiple Site Targeting in Arabidopsis. PLoS ONE, 11(9), e0162169.

+ Open protocol

+ Expand

Mutagenesis of IP3R3 Calcium Channel

Check if the same lab product or an alternative is used in the 5 most similar protocols

A two-step QuikChange mutagenesis protocol was used to introduce amino acid substitutions into cDNA encoding the human IP₃R3 (hIP₃R3; NM_002224.4) in pDNA3.1. Mutagenesis and all DNA modifications were carried out using Pfu Ultra II Hotstart 2X Master Mix (Agilent). Mutagenesis primers for hIP₃R3 T1424M forward (CTGCTACGTAGACATGGAGGTGGAGATG), hIP₃R3 T1424M reverse (CATCTCCACCTCCATGTCTACGTAGCAG) were synthesized by Integrated DNA Technologies (IDT). In addition to encoding the specified mutations, primers also silently introduced a restriction site for verification purposes. The coding regions for all constructs were confirmed by sequencing. hIP₃R3 V615M and hIP₃R3 R2524C mutant cDNAs were obtained from Julika Neumann (KU Leuven).

Terry L.E., Arige V., Neumann J., Wahl A.M., Knebel T.R., Chaffer J.W., Malik S., Liston A., Humblet-Baron S., Bultynck G, & Yule D.I. (2022). Missense mutations in inositol 1,4,5-trisphosphate receptor type 3 result in leaky Ca2+ channels and activation of store-operated Ca2+ entry. iScience, 25(12), 105523.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!