Total cellular DNA was extracted with a Universal Genomic DNA Extraction Kit (Takara) according to the manufacturer's protocol. Then real-time-PCR was performed using the PrimeScript ® RT reagent kit (TaKaRa) and an ABI 7500 Sequence Detection System. The sequences of the primers were as follows: mt-ATP6 Forward: 5′-CGCCACCCTAGCAATATCAA-3′, Reverse: 5′-TTAAGGCGACAGCGATTTCT-3′; Rpl13: Forward: 5′-CTCGAGTCATCACTGAGGAA-3′, Reverse: 5′-CAACATCCTGTTCTGCGGCTT-3′. The level of gene expression was normalized by a standard curve and relative expression was calculated as mt-Atp6/Rpl13.
Abi 7500 sequence detection system
Manufactured by Takara Bio
Sourced in Japan
The ABI 7500 Sequence Detection System is a real-time PCR instrument designed for life science research. It is capable of performing quantitative and qualitative analysis of nucleic acid samples.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Primescript rt reagent kit, by Takara Bio (3 mentions)
Sybr premix ex taq, by Takara Bio (3 mentions)
Iscript cdna synthesis kit, by Bio-Rad (2 mentions)
Universal genomic dna extraction kit, by Takara Bio (1 mentions)
Trizol extraction reagent, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr kit, by Takara Bio (1 mentions)
Reverse transcriptase, by Takara Bio (1 mentions)
Geneamp pcr system 2400 thermal cycler, by PerkinElmer (1 mentions)
Sybr premix ex taq kit, by Takara Bio (1 mentions)
7 protocols using abi 7500 sequence detection system
1
Quantifying Mitochondrial Genome Expression
2
Quantitative Real-Time PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from isolated cell populations using the TRIzol extraction reagent (Thermo Fisher). Then, the RNA was reverse transcribed to cDNA using M-MLV Reverse Transcript reagent (Thermo Fisher). Quantitative real-time PCR (qRT-PCR) was performed with SYBR Green PCR kit (TaKaRa Bio Inc, Otsu, Shiga, Japan) and analyzed in an ABI 7500 Sequence Detection System. The primers for qRT-PCR are listed in Supplementary Table 5 . GAPDH was used as the reference gene for normalization.
3
Quantitative Real-Time PCR for lin28a and let7a
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by using TRIZOL reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. The first strand cDNA was generated from total RNA with reverse transcriptase (TAKARA, Shiga, Japan) and used as the template for qRT-PCR analysis. GAPDH cDNA was used as an internal control to normalize variances. Primers used were as follows: lin28a, 50-GAGGCAGTGGAGTTCACCTTTA-30 (forward) and 50-TCCTTGGCATGGTGGTCTA-30 (reverse); GAPDH, 50-GGCACAGTCAAGGCTGAGAATG-30 (forward) and 50-ATGGTGGTGAAGACGCCAGTA-30 (reverse); let7a, 50-CGGTGAGGTAGTAGGTTGTATAGTT-30 (forward). PCR was performed in a GeneAmp PCR system 2400 Thermal Cycler (Perkin-Elmer, Norwalk CT, USA). PCR conditions were 30 sec. at 94°C, 30 sec. at 58°C and 30 sec. at 72°C (30 cycles). The PCR products were detected by real-time PCR detection kit (RR716; TAKARA) in ABI 7500 sequence detection system.
4
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the cells was prepared with TRIzol Reagent (Invitrogen). Complementary DNAs (cDNAs) were synthesized using the iScript cDNA Synthesis Kit (Bio‐Rad) according to the manufacturer's instructions. Quantitative real‐time PCR was carried out using the ABI 7500 Sequence Detection System and SYBR Premix Ex Taq (Takara, Japan). The following primers were used: Runx2: forward 5′‐CCGCC TCAGTGATTTAGGGC −3′, reverse 5′‐ GGGTCTGTAATCTGACTCTG TCC −3′. ALP: forward 5′‐TGAGGGTGTGGCTTACCAG‐3′, reverse 5′‐ GATGGACGTGTAGGCTTTGCT‐3′. OCN: forward 5′‐CCTCAC ACTCCTCGCCCTATT‐3′, reverse 5′‐CCCTCCTGCTTGGACACAAA‐3′. GAPDH：forward 5′‐ATGGGGAAGGTGAAGGTCG‐3′ reverse 5′‐GGGG TCATTGATGGCAACAATA‐3′. Sp7: forward 5′‐ATGGCGTCCTCTCTGCTTG‐3′, reverse 5′‐TGAAAGGTCAGCGTATGGCTT‐3′. All of the reactions were performed in triplicate.
5
Quantitative RT-PCR analysis of bone tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from bone tissues or cells was prepared with TRIzol Reagent (Invitrogen). Complementary DNAs (cDNAs) were synthesized using the iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA) according to the manufacturer's instructions. Quantitative real-time PCR was carried out using the ABI 7500 Sequence Detection System and SYBR Premix Ex Taq (Takara, Japan). The primer sequences are listed in Supplementary Table 1 .
6
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using TRIzol reagent (Invitrogen) according to the manufacturer's protocol. Then reverse transcription was performed with the PrimeScript® RT reagent kit (Takara), followed by real-time PCR using an ABI 7500 Sequence Detection System with a SYBR® Premix Ex Taq™ kit (Takara). The sequences of the specific PCR primers were as follows: Parkin: Forward: 5′-GAGTCCAGGAGCTTGACACGAGT-3′, Reverse: 5′-AAGGGATGCTGCGCCTGTTGC-3′; p21: Forward: 5′-ATGTCCAATCCTGGTGATGT-3′, Reverse: 5′-TGCAGCAGGGCAGAGGAAGT-3′;β-actin: Forward: 5′-TCGACAACGGCTCCGGCAT-3′ Reverse: 5′-AAGGTGTGGTGCCAGATTTTC-3′. β-actin was used as the internal control.
7
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from dorsal skin samples using the TRIzol reagent. Equivalent amounts of RNA were reverse transcribed using the PrimeScript RT Reagent Kit (Takara, Tokyo, Japan). Thereafter, qRT-PCR was performed by amplifying cDNA prepared from the isolated RNA with SYBR Premix Ex Taq (Takara, Tokyo, Japan) using an ABI 7500 Sequence Detection system. β-Actin was used as an internal control. The amount of mRNA relative to the internal control was calculated using the equation 2−△△CT. The primer sequences used are listed in Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!