B6 cg scn1atm1.1dsf j

The conditional Scn1a-A1783V mice (B6(Cg)-Scn1atm1.1Dsf/J, The Jackson Laboratory, stock no. 026133) were bred to mice expressing Cre recombinase under the control of the CMV promoter (B6.C-Tg(CMV-Cre)1Cgn/J, The Jackson Laboratory, stock no. 006054^{39 (link)}). Breeding pairs consisted of heterozygous male Scn1a-A1783V and homozygous female CMV-Cre mice. See https://www.jax.org/strain/026133 for details about allele modification and genotyping. Offspring carrying one mutated allele (genotype hereinafter referred to as Scn1a^WT/A1783V) express the A1783V mutation in the Scn1a gene in all body tissues, mimicking what happens in DS. Animals were housed 4–6 per cage with free access to food and water, weighed weekly, and maintained in a temperature and light controlled (12 h/12 h light/dark cycle) environment. The studies were performed by comparing heterozygous transgenic Scn1a^WT/A1783V to age-matched negative littermates Scn1a^WT/WT. Breeding and experimental protocols were approved by the Ethical Committee of the University of Navarra (in accord with the Spanish Royal Decree 53/2013).

The conditional Scn1a-A1783V mice [B6(Cg)-Scn1atm1.1Dsf/J, The Jackson Laboratory, stock no. 026133] were bred to mice expressing Cre recombinase under the control of the CMV promoter [B6.CTg(CMV-Cre)1Cgn/J, The Jackson Laboratory, stock no. 006054]. Breeding pairs consisted of heterozygous male Scn1a-A1783V and homozygous female CMV-Cre mice. See https://www.jax.org/strain/026133 for details about allele modification and genotyping. Offspring carrying one mutated allele (genotype hereinafter referred to as Scn1a^WT/A1783V and the mice referred to as DS mice throughout the text) express the A1783V mutation in the Scn1a gene in all body tissues, mimicking what happens in DS. Animals were housed four to six per cage with free access to food and water, weighed weekly, and maintained in a temperature and light controlled (12/12 h light/dark cycle) environment. The studies were performed by comparing heterozygous transgenic Scn1a^WT/A1783V to age-matched negative littermates Scn1a^WT/WT (referred to as WT mice throughout the text). Breeding and experimental protocols were approved by the Ethical Committee of the University of Navarra (in accord with the Spanish Royal Decree 53/2013). These animals have been previously characterized (Ricobaraza et al., 2019 (link)). Five age-matched (7 weeks) animals were used for each group.

Mice were maintained at San Raffaele Scientific Institute Institutional mouse facility (Milan, Italy) and supplied with autoclaved food and water. The conditional Scn1a^{floxedA1783V/+} mice [B6(Cg)-Scn1atm1.1Dsf/J, The Jackson Laboratory, strain no. 026133] were bred to UBC-Cre-Ert2 mice [B6.Cg-Ndor1Tg(UBC-cre/ERT2)1Ejb/1J The Jackson Laboratory, strain no. 007001]. Mice were genotyped with the following primers: Scn1a^{floxedA1783V/+}: 24472_ Forward GCAACTCTTCACATGGTACTTTCA; 24473_Common GCACCTCTCCTCCTT AGAACA; 24489_Mutant Forward GGAGAAACACGAGCAGGAAG; UBC-CRE-ERT2: 25285_Transgene Forward GACGTCACCCGTTCTGTTG; oIMR7338_Internal Positive Control Forward CTAGGCCACAGAATTGAAAGATCT; oIMR7339_Internal Positive Control Reverse GTAGGTGGAAATTCTAGCATCATCC; oIMR9074_ Transgene Reverse AGGCAAATTTTGGTGTACGG. PCR protocols available on Jackson website were used. To assess the efficiency of Cre-mediated recombination, mice carrying the UBC-Cre-ERT2 allele were crossed with mice carrying the Ai9 mice (The Jackson Laboratory, strain no. 007909). All procedures were performed according to protocols approved by the internal IACUC and reported to the Italian Ministry of Health according to the European Communities Council Directive 2010/63/EU.