Tri reagent solution

Total mRNA was extracted from human aorta tissues and HASMCs by using TRI Reagent® solution (AM9738; ThermoFisher Scientific). The precipitated mRNA was dissolved in nuclease-free water, and the RNA concentration was determined by a Nanodrop2000 (ThermoFisher Scientific). Subsequently, mRNA was reverse transcribed into cDNA by using a Transcriptor First Strand cDNA Synthesis Kit (4896866001, Roche). Then, 2 μl of the cDNA solution, primers, DEPC water and Hieff® qPCR SYBR® Green Master Mix (YEASEN, 11201ES08) were added to each well for the real-time PCR assay. Furthermore, the relative mRNA levels were detected by the CFX Connect™ Real-Time PCR Detection System (Bio-Rad). The primers used in this study are listed in Supplementary Table 2.

Testes were dissected as described above and transferred to tubes containing 200 μL Tri Reagent Solution (ThermoFisher, Catalog #AM9738). Individual testes were homogenized with a plastic pestle (USA Scientific, Catalog #1415–5390) and vortexed every 2 minutes over 10 minutes and kept at room temperature. 20 μL of 1-Bromo-3-chloropropane (BCP) was added to the samples then vortexed and incubated at room temperature for 5 min before a 15 minute centrifugation at 14,000 RPM. 80 μL of the top clear layer was transferred to a fresh RNase-free 1.5 mL tube. 0.8 μL of 20 μg/mL glycogen (ThermoFisher, Catalog #R0551) and 80 μL of 100% isopropanol were added to each tube and the samples were placed at -20° C overnight. The tubes were centrifuged at 14,000 RPM for 30 min and the supernatant was removed. The pellets were washed with 300 μL of 75% ethanol and allowed to air dry. RNA pellets were resuspended in 7 μL of nuclease-free water (ThermoFisher, Catalog #4387937). RNA was quantified using a NanoDrop 1000 Spectrometer (ThermoFisher). RNA was treated with DNase I to remove genomic DNA (ThermoFisher, Catalog #18068–015). First-strand cDNA was synthesized using SuperScript First-Strand Synthesis System for RT-PCR (ThermoFisher Catalog #11904–018).

Total RNA was isolated from primary astrocytes, brain regions, and the intestines of WT mice with TRI Reagent® Solution (Thermo Fisher Scientific). After sacrifice by cervical dislocation, the brains and intestines were isolated. The cerebral cortex, cerebellum, hypothalamus, and midbrain were carefully removed from the brain. Total RNA (1 μg) from cells or tissues was used for cDNA synthesis (GoScript Reverse Transcription System, Promega, Madison, WI, USA). PCR was performed using cDNA (1 μL) and the following primer sets: GC-C S: 5′TGCGCTGCTGGTGTTGTGG3′, AS:5′CCCGAGGCCTGTCTTTTCTGTAA3′ (product size 341 bp); GAPDH S: 5′ACGGCCGCATCTTCTTGTG3′; AS: 5′CCCATTCTCGGCCTTGACTG3′ (product size 235 bp) in the following conditions: 2 min at 94 °C, 30 s at 58.8 °C, 1 min at 72 °C (1 cycle); 30 s at 94 °C, 30 s at 58.8 °C, 1 min at 72 °C (30 cycles). The primer set for GC-C was designed to give equal product size for both GC-C isoforms. PCR products were analyzed by agarose gel electrophoresis. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression was used as cDNA control, and the negative control was the reaction mixture without cDNA. PCR products were verified by sequencing.

Total RNA from cell lines was extracted using TRI Reagent Solution (Thermo Fisher Scientific) or Direct-zol RNA Miniprep (Zymo Research) according to the manufacturer’s instructions. Total RNA from FFPE samples was extracted from 5 sections of 5 µm thickness using High Pure FFPET RNA isolation kit (Roche) according to the manufacturer’s instructions. Total RNA was purified from plasma using two extraction kits, according to the available volume of plasma samples. MiRNeasy Serum/Plasma Advanced Kit (QIAGEN) was used, according to the manufacturer’s instructions, to extract RNA from 600 µl of plasma eluted in a final volume of 15 µl, while Plasma/Serum Circulating and Exosomal RNA Purification Mini Kit (Norgen) was employed, according to the manufacturer’s instructions, to extract RNA from 1 ml of plasma eluted in a final volume of 100 µl. Only RNA samples extracted with the same method were pooled together for analysis.

RNA was isolated from subcellular fractions using the TRI Reagent solution (AM9738; Thermo Fisher Scientific). 500 μl of TRI Reagent was mixed with the sample and kept at room temperature for 8 min into each sample, 100 μl of chloroform was added, mixed and shaken for 15 s, followed by incubation at room temperature for 10 min. The samples were then centrifuged at 12,000g for 15 min at 4°C. Upon transfer of the aqueous phase to a new tube, 250 μl of isopropanol was added, followed by immediate vortexing for 15 s. The samples were precipitated in −20°C overnight. The next day, samples were centrifuged at 20,000g for 15 min at 4°C. After discarding the supernatant, the pellets were washed with 500 μl of 75% ethanol. The RNA pellets were subsequently dissolved in an appropriate volume of RNase free water and treated with RNase-Free DNase (79254; Qiagen) by incubation at room temperature for 10 min to avoid genomic DNA contamination. Furthermore, the RNA samples were cleaned and concentrated using Agencourt RNAClean XP beads (A63987; Beckman Coulter) following the 1.8× reaction volume protocol. The RNA concentration was estimated by Quantus Fluorometer (Promega) or NanoDrop Spectrophotometer (Thermo Fisher Scientific). For library generation, the integrity of RNA was verified by 2200 TapeStation system (Agilent Technologies). The RNA samples were stored in −80°C until further use.