circ-PVT1 or ZEB1 overexpression vector was generated by introducing circ-PVT1 or ZEB1 cDNA sequence into pcDNA3.1 empty vector (pcDNA, Addgene, Inc., Cambridge, MA, U.S.A.), termed circ-PVT1-pcDNA3.1 (circ-PVT1), ZEB1-pcDNA3.1 (ZEB1). Short hairpin RNA (shRNA) against circ-PVT1 (sh-circ-PVT1) shRNA against ZEB1 (sh-ZEB1) and their negative control (sh-NC) were purchased from GeneCopoeia (Rockville, MD, U.S.A.). MiR-124-3p mimic (miR-124-3p), miR-124-3p inhibitor (anti-miR-124-3p), and their corresponding negative control (miR-NC, anti-miR-NC) were purchased from GenePharma (Suzhou, China). Transfection of all plasmids and oligonucleotides was carried out by the Lipofectamine 3000 reagents (Invitrogen).
Sh nc
Manufactured by GeneCopoeia
Sourced in United States, China
Sh-NC is a short hairpin RNA (shRNA) that serves as a negative control. It is designed to not target any known human or mouse genes, making it a suitable control for shRNA-based gene knockdown experiments.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 3000, by Thermo Fisher Scientific (3 mentions)
Anti mir nc, by RiboBio (3 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (3 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (3 mentions)
Mcf 10a, by BNCC (2 mentions)
Si nc, by RiboBio (2 mentions)
Sh hotair, by GeneCopoeia (2 mentions)
Si nc, by GeneCopoeia (2 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (2 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (2 mentions)
Si circccdc66, by GenePharma (1 mentions)
Si circ ccdc66, by Thermo Fisher Scientific (1 mentions)
Anti mir nc, by GeneCopoeia (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions)
A2058, by American Type Culture Collection (1 mentions)
Mir 449b 5p inhibitor, by GenePharma (1 mentions)
Nc mimics nc inhibitor, by GenePharma (1 mentions)
Lipofectamine 2000 transfection reagent, by Thermo Fisher Scientific (1 mentions)
Lipo2000, by Thermo Fisher Scientific (1 mentions)
19 protocols using sh nc
1
Overexpression and Silencing of circ-PVT1 and ZEB1
2
Circular RNA CCDC66 Knockdown Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Small interfering (si) RNAs targeting circ-CCDC66 (si-circ-CCDC66#1 and #2), LARP1 siRNA, and corresponding negative controls were synthesized by GenePharma (Shanghai, China). The mimic/inhibitor miR-129-5p and the negative control were also obtained from GenePharma. Short hairpin (sh) RNA targeting circ-CCDC66 (sh-circ-CCDC66) and sh-NC were designed and purchased from Genecopoeia (Guangzhou, China). The lentiviral vector for circ-CCDC66 was purchased from GeneCreate Biological Engineering (Wuhan, China). Cell transfection was performed using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions, and the transfection efficacy was tested at 48 h. The sequence of siRNAs used was: si-circ-CCDC66 #1, sense: 5ʹ-AUUUUCUUUGCAGUUCUUGUU-3ʹ, antisense: 5ʹ-CAAGAACUGCAAAGAAAAUGG-3ʹ; si-circ-CCDC66 #2, sense: 5ʹ-AAUAUAUAAUUUUUUCCUCUA-3ʹ, antisense: 5ʹ-GAGGAAAAAAUUAUAUAUUCA-3ʹ; LARP1 siRNA, sense: 5ʹ-AUAGUUAAAACUUCAGAACAA-3ʹ, antisense: 5ʹ- GUUCUGAAGUUUUAACUAUUA-3ʹ. Transfection ef-ficiency of more than 70% was considered as an effective transfection.
3
Overexpression and Silencing of Circular FOXM1 in Melanoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Normal human epidermal melanocytes (HEMn) and melanoma cells (A2058 and A375) were all bought from the American Type Culture Collection (ATCC, Manassas, VA, USA). These cells were grown in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS; Gibco) and 1% penicillin-streptomycin (Gibco) at 37 °C in a humidified incubator with 5% CO2.
The overexpression vector of circ-FOXM1 (circ-FOXM1), the overexpression vector of FLOT2 (FLOT2) and their control (pcDNA), small interfering RNA (siRNA) against circ-FOXM1 (si-circ-FOXM1) and negative control (si-NC), mimics of miR-143-3p (miR-143-3p) and control mimic (miR-NC), inhibitors of miR-143-3p (anti-miR-143-3p) and its control (anti-miR-NC), and short hairpin RNA against circ-FOXM1 (sh-circ-FOXM1) and its control (sh-NC) were bought from GeneCopoeia (Guangzhou, China). The synthetic vectors or oligonucleotides were transfected into cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA).
The overexpression vector of circ-FOXM1 (circ-FOXM1), the overexpression vector of FLOT2 (FLOT2) and their control (pcDNA), small interfering RNA (siRNA) against circ-FOXM1 (si-circ-FOXM1) and negative control (si-NC), mimics of miR-143-3p (miR-143-3p) and control mimic (miR-NC), inhibitors of miR-143-3p (anti-miR-143-3p) and its control (anti-miR-NC), and short hairpin RNA against circ-FOXM1 (sh-circ-FOXM1) and its control (sh-NC) were bought from GeneCopoeia (Guangzhou, China). The synthetic vectors or oligonucleotides were transfected into cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA).
4
Knockdown of LINC00667 and YY1 in CRC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the stable knockdown of LINC00667 or YY1 [20 (link)], short hairpin RNAs (shRNAs) targeting LINC00667 (shLINC00667#1/2/3) or YY1 (shYY1) and the negative control shRNA (shNC) were purchased from GeneCopoeia, Inc. (Rockville, MD, USA). MiR-449b-5p mimics, miR-449b-5p inhibitor, and negative control (NC mimics, NC inhibitor) were all purchased from Shanghai GenePharma Inc. (Shanghai, China), along with the YY1-overexpression vector and control (pcDNA3.1). The above plasmids were transfected into HCT116 and LoVo cells using Lipofectamine® 2000 transfection reagent (Invitrogen) according to the manufacturer’s protocol for 48 h. All experimental procedures were repeated for three times. The shRNA sequences for LINC00667 were listed as follows:
shNC: 5′-CCGGCAGATTAGTCTCAACTTGACTCTCGAG AGTCAAGTTGAGACTAATCTG TTTTTG-3′;
shLINC00667#1: 5′-CCGGAAGTTTGACCCTGATTCTCAACTCGAG TTGAGAATCAGGGTCAAAC TTTTTG-3′;
shLINC00667#2: 5′-CCGGTACATGTTTGGTAGAGAACTACTCGAG TAGTTCTCTACCAAACATGTA TTTTTG-3′;
shLINC00667#3: 5′-CCGGTAAACAATAGTGTAGTAACTACTCGAGTAGTTACTACACTATTGTTTA TTTTTG-3′.
shNC: 5′-CCGGCAGATTAGTCTCAACTTGACTCTCGAG AGTCAAGTTGAGACTAATCTG TTTTTG-3′;
shLINC00667#1: 5′-CCGGAAGTTTGACCCTGATTCTCAACTCGAG TTGAGAATCAGGGTCAAAC TTTTTG-3′;
shLINC00667#2: 5′-CCGGTACATGTTTGGTAGAGAACTACTCGAG TAGTTCTCTACCAAACATGTA TTTTTG-3′;
shLINC00667#3: 5′-CCGGTAAACAATAGTGTAGTAACTACTCGAGTAGTTACTACACTATTGTTTA TTTTTG-3′.
5
Targeted Gene Knockdown Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The short hairpin RNAs targeting BBOX1-AS1 (sh-BBOX1-AS1) and LAMC2 (sh-LAMC2), matched scramble control (sh-NC), miR-3940-3p mimic/inhibitor, and mimic/inhibitor NC were assembled by Gene Copoeia (Guangzhou, China). Cell transfection was conducted using Lipo2000 (Invitrogen, USA), according to the manufacturer’s instructions. After 48 h, polymerase chain reaction (PCR) was performed to assess the transfection efficiency.
6
Knockdown and Overexpression of CXCL14
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CXCL14 shRNA (sh-CXCL14 #1, sh-CXCL14 #2) and shRNA negative control (sh-NC) were obtained from GeneCopoeia (Guangzhou, China). pcDNA3.1-CXCL14 (CXCL14-OE) and pcDNA3.1-empty vector (Vector) were purchased from GenePharma (Shanghai, China). Transfection or co-transfection was performed using the Lipofectamine 3000 kit (Thermo Fisher Scientific) according to the manufacturer’s instructions.
7
Hypoxia-Induced Breast Cancer Cell Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two BC cell lines (MDA-MB-231 and MDA-MB-468) and breast epithelial cells (MCF-10A) were brought from BeNa Culture Collection (Beijing, China). In our experiments, BC cells specifically refer to MDA-MB-231 and MDA-MB-468 cells. All cells were maintained in Dulbecco’s modified Eagle medium (DMEM; Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, Carlsbad, CA, USA), penicillin (100 U/mL), and streptomycin (100 mg/mL) (Gibco) at 37 °C with 5% CO2. For hypoxia stimulation, BC cells were grown in a hypoxia chamber with 1% O2 at particular times (0, 3, 6, 12, 24, and 48 h).
The small interfering RNA against circ_0001982 (si-circ_0001982) and its negative control (si-NC), the inhibitor of miR-1287-5p (anti-miR-1287-5p) and its negative control (anti-miR-NC), and the small interfering RNA against-MUC19 (si-MUC19) were bought from Ribobio (Guangzhou, China). Lentivirus based short hairpin RNA for circ_0001982 (sh-circ_0001982) and negative control (sh-NC) were constructed by GeneCopoeia (Rockville, MD, USA). These oligonucleotides were transfected into the BC cells using the Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s instructions.
The small interfering RNA against circ_0001982 (si-circ_0001982) and its negative control (si-NC), the inhibitor of miR-1287-5p (anti-miR-1287-5p) and its negative control (anti-miR-NC), and the small interfering RNA against-MUC19 (si-MUC19) were bought from Ribobio (Guangzhou, China). Lentivirus based short hairpin RNA for circ_0001982 (sh-circ_0001982) and negative control (sh-NC) were constructed by GeneCopoeia (Rockville, MD, USA). These oligonucleotides were transfected into the BC cells using the Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s instructions.
8
MPTP-induced Parkinson's model in mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57BL/6 mice (male, ten weeks old) were obtained from Vital River Laboratory Animal Technology (Beijing, China) and were maintained in specific pathogen-free conditions with a 12 h light/dark cycle and free access to water and food. Mice were randomly divided into four groups: vehicle control (con), MPTP, MPTP + sh-NC and MPTP + sh-HOTAIR. Every group was assigned to minimize animals (n = 8 per group) under the approval of the Animal Research Committee of the Central Hospital of Jingzhou. MPTP hydrochloride (Sigma) was intraperitoneally injected at 2 h intervals at a dose of 20 mg kg−1 body weight. The con group was treated with equivalent volumes of sterile saline solution. The lentivirus vector of short hairpin RNA (shRNA) against HOTAIR (sh-HOTAIR) or shRNA negative control (sh-NC) (20 nM) constructed by GeneCopoeia (Rockville, MD, USA) was introduced into the midbrains of the mice 2 days before establishment of the MPTP-induced PD model. The mice were sacrificed 5 days after the last injection of MPTP, and midbrain samples were collected. Proportions of midbrains (n = 4 per group) were fixed with 10% formalin (Sigma), dehydrated and embedded for immunohistochemistry. The other samples were stored at −80 °C until use.
9
Lentiviral Knockdown of FBXO9, FBXW7, and ZNF143
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Short hairpin RNA (shRNA) targeting FBXO9 (shFBXO9#1/shFBXO9#2), FBXW7 (shFBXW7#1/shFBXW7#2), and their negative control (shNC) were purchased from GeneCopoeia (Rockville, USA). Human FBXO9 cDNA (NM_033480.2) and FBXW7 cDNA (NM_033632.3) were subcloned into Lv201 or Lv105 vector (GeneCopoeia). The ZNF143 related plasmids (ZNF143/shZNF143#1/shZNF143#2) are as described in our previous study (21 (link)). All the shRNA target sequences are listed in Supplementary Table S2
10
Breast Cancer Cell Line Manipulation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BC cell lines BT20, BT549, MDA‐MB‐231 (MB‐231), and MDA‐MB‐468 (MB‐468) and normal human breast epithelial cells (MCF10A) were bought from BeNa Culture Collection (Beijing, China). MCF‐10A cells were allowed to grow in mammary epithelial growth medium (MEGM; Lonza Clonetics, Walkersville, MD, USA) supplemented with 100 ng·mL−1 cholera toxin (Sigma‐Aldrich, St. Louis, MO, USA). The BC cell culture medium was the RPMI‐1640 medium (Invitrogen, Carlsbad, CA, USA) with 10% fetal bovine serum (FBS; Invitrogen). All cells were maintained at constant temperature incubator with 5% CO2 at 37 °C.
The small interfering RNA (siRNA) against circ_0008039 or SKA2 (si‐circ_0008039 or si‐SKA2) and matched control (si‐NC), miR‐140‐3p mimic or inhibitor (miR‐140‐3p or anti‐miR‐140‐3p) and matched control (miR‐NC or anti‐miR‐NC), SKA2 or circ_0008039 overexpression plasmid (SKA2, circ_0008039), and matched control (vector) were obtained from RiboBio (Guangzhou, China). Lentivirus‐mediated shRNA interference targeting (sh‐circ_0008039) and its negative control (sh‐NC) constructed by GeneCopoeia (Rockville, MD, USA). For cell transfection, MB‐231 and MB‐468 cells with 60–70 confluences were transfected with oligonucleotide or vector using Lipofectamine 3000 (Invitrogen).
The small interfering RNA (siRNA) against circ_0008039 or SKA2 (si‐circ_0008039 or si‐SKA2) and matched control (si‐NC), miR‐140‐3p mimic or inhibitor (miR‐140‐3p or anti‐miR‐140‐3p) and matched control (miR‐NC or anti‐miR‐NC), SKA2 or circ_0008039 overexpression plasmid (SKA2, circ_0008039), and matched control (vector) were obtained from RiboBio (Guangzhou, China). Lentivirus‐mediated shRNA interference targeting (sh‐circ_0008039) and its negative control (sh‐NC) constructed by GeneCopoeia (Rockville, MD, USA). For cell transfection, MB‐231 and MB‐468 cells with 60–70 confluences were transfected with oligonucleotide or vector using Lipofectamine 3000 (Invitrogen).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!