Instagene matrix

DNA extraction was performed using the commercial InstaGene Matrix method (Bio-Rad Laboratories Inc, California, USA). Two to four colonies were retrieved from Middlebrook 7H11 agar and placed into 1 mL of sterile water, vortexed and then sonicated for 20 minutes. The resultant suspensions were centrifuged at 11,000 rpm for 1 minute. The supernatant was discarded and the residual pellet was resuspended in 200 mL of InstaGene Matrix (Bio-Rad), mixed by vortex and incubated at 56°C for 20 minutes. Samples were then boiled for 8 minutes and centrifuged (13,200 rpm) for 2 minutes prior to use. Samples were used within 24 hours or stored at -20°C. The resultant DNA extract was diluted to 1:100 using molecular-biology grade water (Eppendorf, North Ryde, Australia) prior to undergoing PCR.

Total DNA was extracted using the commercial kit Instagene Matrix^TM (BIO-RAD, Hercules, CA, USA) according to manufacturer recommendations. PCR assays were used to detect the β-lactamase-encoding genes bla_TEM, bla_SHV, bla_CTX-M (Sánchez et al., 2006 (link); Woodford et al., 2006 (link); Geser et al., 2012 (link)). The PCR products were sequenced (Macrogen, Seoul, Korea) and the nucleotide sequences and their derived amino acid sequences were compared to the existing sequences in the GenBank database (National Center for Biotechnology Information, NCBI) and in the Lahey β-lactamase classification database² using the BLAST³, and ExPASy translate tools⁴. Sequences were aligned using Clustal-Omega software⁵. Additional genes of antibiotic resistance, such as plasmid-mediated quinolone resistance (PMQR) genes [qnrA, qnrB, qnrS, qnrC, qnrD, aac(6′)Ib-cr; (Chen et al., 2012 (link))], were included in order to further characterize the strains. In all strains, the carbapenemase gene was confirmed by PCR. All the primers are listed in Table S1.

The NRC-ABB tested stool samples for Bacillus cereus using molecular biology. Genomic DNA was extracted using InstaGene MatrixTM (BioRad France, Marnes-la-Coquette, France) according to the supplier’s protocol. PCR targeting genes encoding B. cereus non hemolytic enterotoxin (nheA) and emetic toxin (ces) was also performed as described (Table 6).

One hundred (100) presumptive E. coli isolates were randomly selected and inoculated separately into 5 mL Erlenmeyer flasks containing 2 mL nutrient broth (Merck, Johannesburg, South Africa). The flasks were incubated overnight at 37 °C on a rotary shaker at 100 rpm. DNA was extracted from 1 mL of the overnight culture using the InstaGene^TM Matrix (Bio-Rad Laboratories, Johannesburg, South Africa) following the manufacturer’s instruction. The template DNA was stored at −20 °C for PCR assays. All selected samples were first confirmed as E. coli by testing for the presence of the malate dehydrogenase (mdh) gene which is found in most E. coli strains [21 (link)]. After that, the presence of a total of eight VGs (eaeA (EPEC/EHEC), eagg (EAEC), ipaH (EIEC), ST (ETEC), ibeA (NMEC), stx1 (EHEC), stx2 (EHEC) and flicH7 (EHEC)) were investigated. The primer sequences and the PCR-cycling conditions for the identification of the various VGs were as previously described by Abia et al. [19 (link)]. Both multiplex and singleplex PCR assays were performed for the target genes. Multiplex PCR assays were divided into 3 sets where set 1 contained eaeA, eagg and ipaH, set 2 contained flicH7 and Stx1 and finally set 3 contained ST and ibeA genes [19 (link),22 (link),23 (link)]. Singleplex real-time PCR assays were performed for the mdh and stx2 target genes [24 (link),25 (link)].

The obtained pellets were resuspended in 100 µL of lysis buffer (InstaGene^TM Matrix, Bio-Rad, München, Germany) and briefly vortexed. The samples were then heated at 130 °C for 7 min in a prototypal battery-operated device. After 7 min incubation time, the samples were left to cool down for a few minutes and were directly processed in the LAMP reactions, with no purification steps.

The presence of acquired class D carbapenemases genes common for Acinetobacter spp. (groups OXA-23, OXA-24/40, and OXA-58), as well as class B carbapenemases (metallo-beta-lactamases (MBL) of VIM, IMP, and NDM groups) were determined by real-time PCR using commercial kits “AmpliSensR MDR Acinetobacter-OXA-FL” and “AmpliSensR MDR MBL-FL” (Central Research Institute of Epidemiology, Moscow, Russia). For amplification, a DTPrime 5X1 real-time PCR system (DNA Technology, Moscow, Russia) was used. Strains A. baumannii, A. pittii, and P. aeruginosa, carring the known carbapenemases genes of the listed groupswere used as positive controls. DNA extraction was performed by express method using InstaGeneTM matrix (Bio-Rad, Hercules, CA, USA). Samples of extracted DNA were stored at −20 °C before testing. The results of assessing the sensitivity to antibiotics and determining the genes of various types of carbapenemases have been deposited to the AMRmap website database [49 (link)].

DNA was extracted using the InstaGene^TM Matrix according to the manufacturer’s instructions (Bio-Rad, Milan, Italy). The D1/D2 domains of the 26S rRNA gene was amplified for the yeast identification using the NL1 (5′ GCATATCAATAAGCGGAGGAAAAG 3′) and NL4 (5′ GGTCCGTGTTTCAAGACGG 3′) primer pair [23 (link)]. The PCR products were purified by ExoSAP-IT (Thermo Fisher, Milan, Italy) according to the manufacturer’s instructions and delivered to BMR Genomics (Padua University, Padua, Italy) for sequencing. The obtained sequences were compared to those available in the GenBank database (http://www.ncbi.nml.nih.gov/BLAST, accessed on 3 January 2024) in order to determine the closest known relative species on the basis of the 26S rRNA gene homology.
The strains were typed by RAPD-PCR with the primer M13 (5′ GAGGGTGGCGGTTCT 3′), as previously described [24 (link)]. The Fingerprinting II Informatix^TM software program (Bio-Rad, Milan, Italy) was employed for the conversion and normalization of the RAPD-PCR patterns. The similarities among the profiles were calculated by clustering the Pearson’s r correlation matrix using the unweighted pair group method with average (UPGMA) algorithm.