Absolutely rna microprep kit

Manufactured by Agilent Technologies

Sourced in United States

The Absolutely RNA Microprep Kit is a laboratory product designed for the isolation and purification of total RNA from small samples. It employs a simple and efficient method to extract high-quality RNA from a variety of sources, including cells, tissues, and microorganisms.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Absolutely RNA kit (14 citations) Absolutely RNA RT-PCR microprep kit (4 citations) Absolutely RNA Microprep (2 citations)

38 protocols using absolutely rna microprep kit

Transcriptome Profiling of Tissue-Resident Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from 2×10⁵ TPCs using the Absolutely RNA Microprep Kit (400805, Agilent Technologies) according to manufacturer’s instructions. RNA quality was defined on an Agilent 2100 Bioanalyzer before we prepared ribo-depleted, multiplexed, paired end libraries with the Illumina TruSeq Stranded Ribozero Gold kit. Multiplexed libraries have been sequenced on an Illumina HiSeq 2500 Genome Analyzer using the 50-base pair paired end read method.

Sastre-Perona A., Hoang-Phou S., Leitner M.C., Okuniewska M., Meehan S, & Schober M. (2019). De novo PITX1 expression controls bi-stable transcriptional circuits to govern self-renewal and differentiation in squamous cell carcinoma. Cell stem cell, 24(3), 390-404.e8.

+ Open protocol

+ Expand

Quantifying iNOS Expression in Taste Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was prepared from mouse tongue taste epithelium, cultured taste organoids, and RAW 264.7 cells using Absolutely RNA Microprep Kit (Agilent) with DNase I (RNase-free) treatment. cDNA was synthesized using Superscript III reverse transcriptase following the manufacturer recommended protocol. Real-time PCR with gene specific primers was set up using Power SYBR Green master Mix (Thermo Fisher) and run on StepOnePlus Real-Time PCR System equipment (Thermo Fisher). The iNOS gene specific primers used were: 5’-TCAACTGCAAGAGAACGGAGA-3’ and 5’-TGAGAACAGCACAAGGGGTTT-3’. Relative quantification of gene expression was performed based on the 2^−ΔΔCt method (Wang et al., 2007 (link)). β-Actin was used as the endogenous control gene for these analyses. The β-Actin gene specific primers used were: 5’- GATTACTGCTCTGGCTCCTA-3’ and 5’- ATCGTACTCCTGCTTGCTGA-3’.

Leonetti J.P., Machy P., Degols G., Lebleu B, & Leserman L. (1990). Antibody-targeted liposomes containing oligodeoxyribonucleotides complementary to viral RNA selectively inhibit viral replication.. Proceedings of the National Academy of Sciences of the United States of America, 87(7), 2448-2451.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Workflow

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cells using the Absolutely RNA Microprep kit (Agilent, 400805) following manufacturer’s instructions. cDNA was prepared using the High Capacity cDNA RT kit (Applied Biosystems, 4368814) according to the manufacturer’s instructions, and a FlexCycler2 PCR thermal cycler (Analytik Jena, Germany). For long-term storage, RNA was kept at −80°C and cDNA at −20°C. Quantitative real-time PCR (qRT-PCR) was performed using the Power SYBR Green PCR Master Mix (Applied Biosystems, 4367659), 1 µL cDNA, and the gene-specific primers (Table 1). Reactions were run on a 7,500 Fast Real-Time PCR instrument (Applied Biosystems, Germany). The mRNA expression levels of genes of interest were quantified relative to GAPDH expression using the ΔCt method.

Rawat H., Kornherr J., Zawada D., Bakhshiyeva S., Kupatt C., Laugwitz K.L., Bähr A., Dorn T., Moretti A, & Nowak-Imialek M. (2023). Recapitulating porcine cardiac development in vitro: from expanded potential stem cell to embryo culture models. Frontiers in Cell and Developmental Biology, 11, 1111684.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs of the samples were isolated using the Absolutely RNA Microprep kit (Agilent Technologies, Santa Clara, CA, United States). Total cDNA was synthesized by the High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Waltham, MA, United States). The qPCR was performed by using SYBR Green qPCR mix (Invitrogen, Carlsbad, CA, United States) on a light cycler instrument (Bio-Rad Laboratories, Hercules, CA, United States) (Gelderblom et al., 2020 (link)). The primer sequences are listed in Table 1.

Cao L., Zheng K., Liu Y., Song P., Wang C., Wang H., Wang N., Zhang S, & Zhao Y. (2022). Identification of Novel Imatinib-Resistant Genes in Gastrointestinal Stromal Tumors. Frontiers in Genetics, 13, 878145.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Early Embryonic Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

For each condition, 30 embryos were lyzed and total RNA was purified from 3 embryo equivalents using the Absolutely RNA Microprep Kit (Agilent Technologies). First-strand cDNA synthesis was performed with random primers using the AffinityScript Multiple Temperature cDNA Synthesis Kit (Agilent technologies). qPCR was performed using FastStart Essential DNA Green Master Mix (Roche) and a Roche LightCycler 96. PCR efficiency was verified for each primer set, and only primer pairs having amplification efficiencies within 10% of perfect were used. Each 15 µl reaction contained 10 ng cDNA and 0.5 µM of each primer. All reactions were performed in quadruplicate, at a minimum. The following program was used: 95 °C for 600 seconds; 45 cycles of 95 °C for 10 seconds, 60 °C for 15 seconds, 72 °C for 15 seconds; 95 °C for 10 seconds; 65 °C for 60 seconds; increasing at 0.2 °C/second from 65 °C to 97 °C. Gene expression was normalized to ODC (Ornithine decarboxylase) and calculated by the DDCt method. Transcript levels were not normalized for ploidy. Primer sequences were (5′ to 3′):
BIX1.1FW AGCACCTACTTCTCCTCCAGT
BIX1.1REV GCTTGCTGTACTGGACTCTGT
XNR3FW CGATGCCTCCAGTCCTACAG
XNR3REV TCCTTGAAATTCTCTGGCTCCA
XNR5-13FW CCTTTCACTAGGGCATGGGA
XNR5-13REV GGTGAAGGTTCCAGTCTGTGT
ODCFW CTGGAGGAAGGCTTCTCTGC
ODCREV TGTCGCCAAGATCAGCAACA

Jevtić P, & Levy D.L. (2017). Both Nuclear Size and DNA Amount Contribute to Midblastula Transition Timing in Xenopus laevis. Scientific Reports, 7, 7908.

+ Open protocol

+ Expand

qPCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

qPCR was carried out as previously described^{2 (link)}. Cultured cells or tissues were harvested and dissociated according to their specific protocols. RNA was isolated using the Absolutely RNA Microprep Kit (Agilent). Complementary DNA was made using the SuperScript III Kit (Invitrogen) and analyzed using TaqMan Assays (Applied Biosystems) with a StepOnePlus™ Real-Time PCR System (Applied Biosystems) and software as per the manufacturer’s recommendations. Gapdh (4352339E) was used as an endogenous control for normalization.

Rowbotham S.P., Li F., Dost A.F., Louie S.M., Marsh B.P., Pessina P., Anbarasu C.R., Brainson C.F., Tuminello S.J., Lieberman A., Ryeom S., Schlaeger T.M., Aronow B.J., Watanabe H., Wong K.K, & Kim C.F. (2018). H3K9 methyltransferases and demethylases control lung tumor-propagating cells and lung cancer progression. Nature Communications, 9, 4559.

+ Open protocol

+ Expand

Stimulation-Dependent Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

CD4 or Th1 cells were stimulated for 10, 30, 60, 120, and 240 min with 10 ng/mL PMA plus 1 μM Ionomycin. RNA was isolated by the Absolutely RNA Microprep Kit (Agilent Technologies). qPCR was performed with Taqman assays of Applied Biosystems (CA, USA). Taqman probes used were Hs00743856_s1 (PTP4A1), Hs00754750_s1 (PTP4A2), Hs02341135_m1 (PTP4A3), Hs00959886_g1 (PTPN2), Hs00169359_m1 (PTPN6), Hs00978680_m1 (PTPN7), Hs04189704_m1 (PTPRC), Hs00934033_m1 (CD69), and Hs00272002_m1 (GNB2L1, housekeeping gene). Reactions were run in 7900HT Fast Real-Time PCR system (Applied Biosystems). Comparative analysis of the results obtained in different samples was done by using the delta Ct (ΔCt; Ct of the studied gene subtracted by the Ct of the housekeeping gene) or by the method 2^−ΔΔCt (46 (link)) as indicated.

Castro-Sánchez P., Ramirez-Munoz R., Martín-Cófreces N.B., Aguilar-Sopeña O., Alegre-Gomez S., Hernández-Pérez S., Reyes R., Zeng Q., Cabañas C., Sánchez-Madrid F, & Roda-Navarro P. (2018). Phosphatase of Regenerating Liver-1 (PRL-1) Regulates Actin Dynamics During Immunological Synapse Assembly and T Cell Effector Function. Frontiers in Immunology, 9, 2655.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extractions were performed using an Absolutely RNA Microprep kit (Agilent Technologies), according to the manufacturer’s recommendations. For each experiment, the same amount of RNA (mean 1 µg) was used to synthesize cDNA in a 50-µl final volume using Superscript II (Invitrogen) and random hexamers (Roche). Genomic DNA contaminations were avoided by treatment with DNaseI (Absolutely RNA Microprep), and control of genomic contamination was measured by performing the same procedure without reverse transcription. qPCR experiments were performed with 5 ng cDNA per reaction, using a KAPA SYBR FAST reagent (Kapabiosystems) on an Agilent Mx3005P qPCR System. The relative expressions of each gene were normalized to their expression in the respective control condition. All primers were designed using Lasergene 7.2 software (DNAStar) and are presented in Tables S1 and S2. Analyses of the results were performed using Mx Pro-Mx3005P v4.10 and GraphPad Prism software.

Chiapparo G., Lin X., Lescroart F., Chabab S., Paulissen C., Pitisci L., Bondue A, & Blanpain C. (2016). Mesp1 controls the speed, polarity, and directionality of cardiovascular progenitor migration. The Journal of Cell Biology, 213(4), 463-477.

+ Open protocol

+ Expand

RNA Isolation for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the assessment of gene expression at differing days of differentiation, RNA was isolated with the Qiagen RNeasy Kit (#74136) according to manufacturer instructions.
To purify RNA from the sorted cells, cells were sorted directly into 750 μL lysis buffer using the Agilent Absolutely RNA Microprep kit (#400805) and RNA isolated according to kit instructions.

Mukherjee S., Zhang T., Lacko L.A., Tan L., Xiang J.Z., Butler J.M, & Chen S. (2018). Derivation and characterization of a UCP1 reporter human ES cell line. Stem cell research, 30, 12-21.

+ Open protocol

+ Expand

Clonal Cell and Tissue RNA Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Biological replicates for human and mouse clones (see Table 1) were made by growing cells in separate wells of a 6-well plate at a seeding density of 500,000 per mL (1,500,000 total cell per well). RNA isolation and DNase treatment for both clonal cell lines was performed using Absolutely RNA Microprep Kit (Agilent) according to instruction. RNA from C.elegans was prepared using Trizol reagent (Invitrogen), with DNase treatment using TURBO DNA-free kit (Ambion). RNA integrity was assessed using Bioanalyzer and was quantified using Qubit RNA HS Assay. DNase-treated RNA from N2 and Hawaiian strains was mixed in proportions described in Table 1. For RNA preparation from mouse tissues, whole tissues were collected from adult 129xCastF1 mice housed at the DFCI mouse facility, with parent animals obtained from the Jackson Laboratories. All animal work was performed under DFCI protocol 09-065, approved by the DFCI Institutional Animal Care and Use Committee. Animals were housed in accordance with Guide for the Care and Use of Laboratory Animals. Collected tissues were crushed using mortar and pestle in liquid nitrogen. This powdered tissue was either taken directly for RNA isolation using Trizol reagent or stored in liquid nitrogen for later use.

Mendelevich A., Gupta S., Pakharev A., Teodosiadis A., Mironov A.A, & Gimelbrant A.A. (2023). Foreign RNA spike-ins enable accurate allele-specific expression analysis at scale. bioRxiv.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!