Dnase 1 digestion

TRIzol reagent (Invitrogen, Carlsbad, CA) was utilized according to the manufacturer’s protocol to extract total RNA from non-tumorous and tumor tissues. For 0.5 h at 37°C, DNase I digestion (Fermentas, MD, USA) was subjected with 2 μg total RNA. The Omniscript Reverse Transcription kit (Qiagen, Valencia, CA) was used to synthesize the cDNA. The EvaGreen Master Mix (Biotium Inc., Hayward, CA) was used to perform the real-time qPCR assay. The qPCR amplification conditions were as follows: for 120 s at 95°C, following for 15 s at 95°C: 40 cycles, for 45 s annealing temperature. A triplicate was used to run each sample. With the help of the 2^−ΔΔCt relative quantification method, the C_t value of GAPDH (endogenous reference) was utilized to normalize the relative expression levels of each target gene. Primers are presented as:
Each reaction was carried out on the Eppendorf Mastercycler ep realplex system (2S; Eppendorf, Hamburg, Germany) based on the below cycling parameters, for 2 min at 95°C, following at 95°C for 15 s: 40 cycles, for 45 s at 60°C. The experimental protocol was established based on the ethical guidelines of the Declaration of Helsinki. The Human Ethics Committee at Taicang Hospital (No. 2018-K020) granted the ethical permissions. Written informed consent was obtained from the individuals or guardians of the participants.

3xFLAG::GFP::NRDE-2- and 3xFLAG::GFP::NRDE-3-associated pre-rRNAs were isolated from embryo lysates as described previously (5 (link),20 (link)). 20 μl embryos were used in each replicate and 3 biological replicates were performed for each experiment. The lysate was pre-cleared with protein G-agarose beads (Roche) and incubated with anti-FLAG M2 Magnetic Beads (Sigma #M8823). The beads were washed extensively and were eluted with 100 μg/ml 3xFLAG peptide (Sigma #F4799). The eluates were incubated with TRIzol reagent followed by isopropanol precipitation and DNase I digestion (Fermentas).
RNA was reverse transcribed via GoScript™ Reverse Transcription System (Promega #A5001). Quantitative real-time PCR (qPCR) was performed using an MyIQ2 machine (Bio-Rad) with SYBR Green Master Mix (Vazyme, Q111-02). The primers used in this work are listed in Supplementary Table S5.

Total RNA was extracted from cultured cells using TriPure Isolation Reagent (cat. 11667165001, Roche Applied Science, Germany) according to the manufacturer’s instructions.
For real-time quantitative RT-PCR (qPCR) analysis of mRNA, 2 μg of total RNA was subjected to DNaseI digestion (Fermentas, Hanover, MD, USA) at 37°C for 30 minutes and then to heat inactivation of DNaseI at 65°C for 10 minutes, followed by reverse-transcription using Moloney murine leukemia virus reverse transcriptase (Promega). mRNA level was detected using Power SYBR® Green PCR Master Mix (Applied Biosystems) and β-actin was used as an internal control. The primers used for qPCR are listed in Additional file
7: Table S1. For qPCR analysis of miRNA, cDNA was synthesized using the Taqman miRNA reverse transcription kit (Applied Biosystems). The expression levels of miR-26b and the reference gene RNU6B were quantified using the TaqMan MicroRNA Assay Kit (Applied Biosystems).
All reactions were performed on a LightCycler® 480 (Roche Diagnostics, Germany) and were run in triplicate. The cycle threshold (Ct) values did not differ by more than 0.5 among the triplicates. The levels of target genes were normalized to the levels of the internal control genes to permit the calculation of the 2^-ΔΔCt value.

Gal4-Hsp 70 virgin female flies were crossed to UAS-RNAi males. The adult offspring were heat shocked for 45 min at 37°, three times a day at 1-hr intervals, for 2 d. Only female offspring of the cross with UAS-Ptp61F RNAi and UAS-CG8636 RNAi and male offspring of UAS-Fer3hch and UAS-mib2 RNAi were used in this experiment. The RNA was extracted from 5 to 15 heat-shocked offspring using a Qiagen RNeasy mini kit. DNase I digestion (Fermentas) followed by cDNA synthesis (BioRad iScript) was performed using 1 µg of the purified RNA. qRT-PCR was implemented using 300 ng cDNA, 2 µl primer mix (10 µM), and 10 µl iTaq Universal SYBR Green Supermix (BioRad) in a 20 µl reaction. The qRT-PCR experiments were carried out on three biological replicates, each in technical triplicates. Heat shock-driven mCherry RNAi flies were used as a control. Ribosomal protein L32 (rp49) was used as a reference gene. Primers for Ptp61F, Fer3hch, and mib2, listed in Table S2, were designed according to the fly primer bank (Hu et al. 2013 (link)) (http://www.flyrnai.org/flyprimerbank). Primers used for rp49 were: Forward, GTGAAGAAGCGCACCAAGCAC, Reverse, ACGCACTCTGTTGTCGATACCC. Primers for CG8636 were: Forward, AATCAGAATGCCGGGCGTTGA, Reverse, TCACGTACTTCTGTCCGTTCT.

RNA was isolated essentially as described (Collart and Oliviero 2001 ) followed by purification using the RNEasy Mini Kit (QIAGEN, 74,104) and DNase I digestion (Invitrogen, 18068-015). Quantitative RT-PCR was carried out using the Superscript III Platinum SYBR Green One-Step qRT-PCR kit (Invitrogen, 11736-059). RNA samples were normalized relative to the BUD6 mRNA levels as previously described (Holstein et al. 2014 (link)).

HEK293T cells transfected with pUTR-Gag-GFP, pGag-GFP and pGag-GFP-CTE were collected 48 h post-transfection and the cytoplasmic fraction was prepared as described previously [34 (link)]. RNA was extracted using TRIzol LS reagent (Invitrogen) following the manufacturer's instructions. After DNA removal with DNase I digestion (Invitrogen), cDNA was synthesized from 500 ng of RNA by using random primers and SuperScript II reverse transcriptase (Invitrogen). The cytoplasmic Gag-GFP expression and relative quantification were performed with SYBR Green PCR Master Mix on a 7300 Real-Time PCR System (Applied Biosystems) using GFP primer pair 19/20 and human β-actin primer pair 21/22 as the housekeeping gene (Table 1), as described previously [35 (link)].

2 µg of RNA obtained from sorted cells was subjected to DNase I digestion (Invitrogen) and RT-PCR was carried out using SuperScript III First-Strand Synthesis system (Invitrogen) according to manufacturer’s instructions. 100 ng of cDNA template was used for each reaction. Qualitative RT-PCR was performed using a two-phase, step-down PCR method; 16 cycles of 94°C for 30 s, 64°C (−0.5°C/cycle) for 30 s, 72°C for 30 s, followed by 10 cycles of 94°C for 30 s, 56°C for 30 s, 72°C for 30.