Mmlv reverse transcriptase

Manufactured by Illumina

Sourced in United States

MMLV reverse transcriptase is an enzyme used in molecular biology for the synthesis of complementary DNA (cDNA) from RNA templates. It catalyzes the conversion of single-stranded RNA into double-stranded DNA, which can then be used for further analysis or amplification.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

MMLV-Reverse Transcriptase kit MMLV Reverse Transcriptase First-Strand cDNA synthesis kit MMLV High Performance Reverse Transcriptase MMLV Reverse Transcriptase 1st-Strand cDNA Synthesis Kit MMLV HP reverse transcriptase Reverse transcriptase

66 protocols using mmlv reverse transcriptase

Total RNA Isolation and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The isolation of total RNA was performed using TRIzol reagent (Invitrogen, Waltham, MA, USA). MMLV reverse transcriptase (Epicentre Biotechnologies, Madison, WI, USA) was employed to carry out first-strand cDNA synthesis, utilizing 1 μg of total RNA at 37 °C for 60 min. The PCR reactions were run on a Veriti Thermal Cycler (Applied Biosystems, Carlsbad, CA, USA), and the PCR primer sequence and ID number are provided below (Table 1). These primers were synthesized and verified by Mission Biotech Co. Ltd. (Taipei, Taiwan, ROC).

Feng S.W., Wu Z.S., Chiu Y.L, & Huang S.M. (2023). Exploring the Functional Roles of Telomere Maintenance 2 in the Tumorigenesis of Glioblastoma Multiforme and Drug Responsiveness to Temozolomide. International Journal of Molecular Sciences, 24(11), 9256.

+ Open protocol

+ Expand

Quantitative Analysis of Learning-Related miRNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols

We found that miR-146a, miR-9, miR-143 and let-7d might be connected with learning and memory ability through review of the literature and prediction of the target gene[16 (link),17 (link),18 (link)]. In addition, the four miRNAs were found to be expressed with significant difference among three groups. Hence these 4 differentially expressed miRNAs were measured with quantitative reverse transcription (RT) PCR to verify the findings of miRNAs array. A total of 5ug RNA was reverse trascribed to cDNA by utilizing MMLV reverse transcriptase (Epicentre, Madison, WI) according to the manufacturer’s instruction. Specific primers were designed through using the Primer Express software (Applied Biosystems, USA). In presence of SYBR 1 Green (BioFlux, Japanese), quantitative PCR was performed by an ABI PRISM7500 system (Applied Biosystems, Foster Cit, CA). The relative abundance of miRNAs was normalized by the expression level of U6 RNA.

Luo T., Yin S., Shi R., Xu C., Wang Y., Cai J., Yue Y, & Wu A. (2015). miRNA Expression Profile and Involvement of Let-7d-APP in Aged Rats with Isoflurane-Induced Learning and Memory Impairment. PLoS ONE, 10(3), e0119336.

+ Open protocol

+ Expand

RNA Isolation and RT-PCR Analysis

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

H9c2 cells were lysed in TRIzol reagent (Invitrogen) to isolate total RNAs. One microgram RNA was subjected to reverse transcription for first strand cDNA synthesis using MMLV reverse transcriptase for 60 min at 37 °C (Epicentre Biotechnologies, Madison, MI, USA). The PCR reactions were run on a Veriti^TM Simpli Thermal Cycler (Applied Biosystems, Carlsbad, CA, USA) for further agarose gel analysis. The procedural details have been described in our previous publications [47 (link),48 (link)]. The mRNA bands were quantified through pixel density scanning and evaluated using Image J, version 1.44a (http://imagej.nih.gov/ij/, accessed on 13 August 2023). All PCR primer sequences are shown in Table 1.

Hsu P.S., Liu S.T., Chiu Y.L, & Tsai C.S. (2023). The Functional Role of Myogenin in Cardiomyoblast H9c2 Cells Treated with High Glucose and Palmitic Acid: Insights into No-Rejection Heart Transplantation. International Journal of Molecular Sciences, 24(17), 13031.

+ Open protocol

+ Expand

Transient Transfection of Hep3B Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

When Hep3B cells were about 90% confluence in a 12-well plate, transient transfection was initiated using the EcoTransfect reagent as follows: plasmid (1 µg, pGFP²-N2 empty plasmid or cloned pGFP²-N2 plasmid carrying a 12mer peptide DNA) and EcoTransfect reagent (2 µl) were incubated in a final volume of 100 µl of complete media for 20 minutes before being added onto a well containing 1 ml of fresh media. Media was exchanged after 24 hours and cells were harvested 72 hours after transfection. Cells were treated with 10 µM 3MC for the last 6 hours before harvest. Direct-zol kit was used to isolate RNA (with DNase treatment and A₂₆₀/A₂₈₀ > 1.8) and reverse transcription was performed with 1 µg of RNA (estimated by the Fisher Nanodrop Lite) using Epicentre MMLV reverse transcriptase. qPCR was performed with 1 µl of solution after reverse transcription, 10 µl of Bio-Rad SYBR green supermix, and 1 µl (8 pmol) of sequence-specific primers (Table II) using a Bio-Rad CFX Connect real-time PCR machine with the following protocol: 40 cycles of 90°C for 10 second/60°C for 1 minute with fluorescence readings taken at 60°C. The 2^−ΔΔCq method was used to present the normalized values [23 (link)].

Ren L., Thompson J.D., Cheung M., Ngo K., Sung S., Leong S, & Chan W.K. (2016). Selective suppression of the human aryl hydrocarbon receptor function can be mediated through binding interference at the C-terminal half of the receptor. Biochemical pharmacology, 107, 91-100.

+ Open protocol

+ Expand

Quantification of miRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from frozen tissues using TRIzol reagent (Invitrogen). The RNA concentration was quantified by NanoDrop® ND-1000. Extracted RNA was reverse transcribed into complementary DNA using MMLV reverse transcriptase (Epicentre) and RT primers (Invitrogen). RT-PCR was carried out using TaqMan probes (Applied Biosystems) according to the manufacturer's instructions, with Gene Amp PCR System 9700 (Applied Biosystems). All reactions were run in triplicate, and average threshold cycle number (Ct) data of each miRNA was recorded. miRNAs expression in cells was normalized to U6 small noncoding RNA.
The ΔCt method and 2^−ΔΔCt method were used for analysis. The ΔCt value was the difference between the Ct value of the specific miRNA and the Ct value of U6, ΔCt = Ct (miRNA) − Ct (U6). ΔΔCt = ΔCt (sample) − ΔCt (reference). 2^−ΔCt represented miRNAs expression of each sample. 2^−ΔΔCt represented the expression relative quotient (RQ) of target RNA to control RNA.

Zhang J., Huang K., Zhong G., Huang Y., Li S., Qu S, & Zhang J. (2016). Acupuncture Decreases NF-κB p65, miR-155, and miR-21 and Increases miR-146a Expression in Chronic Atrophic Gastritis Rats. Evidence-based Complementary and Alternative Medicine : eCAM, 2016, 9404629.

+ Open protocol

+ Expand

Transcriptional Analysis of C2C12 Differentiation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs were isolated from differentiated C2C12 cells using TRIzol reagent (Invitrogen, Waltham, MA, USA). Reverse transcription for first-strand cDNA synthesis was carried out using MMLV reverse transcriptase (Epicentre Biotechnologies, Madison, WI, USA) with 1 μg of total RNA at 37 °C for 60 min. Specific primers (Table 2) were designed and evaluated by the program “Pick Primers” on the National Center for Biotechnology Information website (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) (accessed on 1 December 2021). Primers, dNTP, and Taq DNA polymerase were added for subsequent PCR reactions, which were processed using a Veriti™ Simpli Thermal Cycler (Applied Biosystems, Foster City, CA, USA).

Hsieh Li S.M., Liu S.T., Chang Y.L., Chen G.S, & Huang S.M. (2022). Identification of Agents That Ameliorate Hyperphosphatemia-Suppressed Myogenin Expression Involved in the Nrf2/p62 Pathway in C2C12 Skeletal Muscle Cells. International Journal of Molecular Sciences, 23(23), 15324.

+ Open protocol

+ Expand

Validation of miR-135a Expression by qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

To verify the microarray results, we performed qRT-PCR to assay screen the miR-135a expression in prepared tissues samples and cell lines. Total RNA was isolated with the Trizol reagent (Invitrogen, Carlsbad, CA, USA). The expression of miR-135a was analyzed with the miScript system (Qiagen, Hilden, Germany) in accordance with the manufacturer's protocol; this system contains the miScript Reverse Transcription kit, miScript Primer assays, and miScript SYBR Green PCR kit. Human U6 RNA was amplified for normalization. SYBR green real-time RT-PCR was adopted to detect Bmi1 mRNA, and the first-strand complementary DNA was synthesized using MMLV reverse transcriptase (Epicentre, Paris, France). Human glyceraldehyde 3-phosphatedehydrogenase (GAPDH) RNA was used as an internal control. The primers used were as follows: Bmi1 forward, 5'GCTTCAAGATGGCCGCTTG3', and reverse, 5'TTCTCGTTGTTCGATGCATTTC3'. All RT-PCR reactions were analyzed using the ABI Prism 7700 Sequence Detector (Applied Biosystems, Foster City, CA, USA) in triplicate for each sample. The fold change for the relative expression levels of each miRNA was calculated using the ^ΔΔCt method 17 (link).

Dang Z., Xu W.H., Lu P., Wu N., Liu J., Ruan B., Zhou L., Song W.J, & Dou K.F. (2014). MicroRNA-135a Inhibits Cell Proliferation by Targeting Bmi1 in Pancreatic Ductal Adenocarcinoma. International Journal of Biological Sciences, 10(7), 733-745.

+ Open protocol

+ Expand

Exosomal miRNA Quantification by qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

The top 3 abundant miRNAs that fulfilled the above listed criteria were validated by qRT-PCR. Total RNA of 50 exosome samples was extracted (described above). The first-strand cDNA was synthesized by different reverse transcription primers using M-MLV reverse transcriptase (Epicentre, USA), which was then used for qRT-PCR analysis (Table 1). qRT-PCR was performed for each sample in triplicate in a QuantStudio 5 Real-time PCR System (Applied Biosystems, USA) by following the manufacturer's instructions and using different primers (Table 2). The primers were synthesized by BIOLIGO Biotech (Shanghai, China). Relative expression of the top 3 miRNAs was assessed the 2^−ΔCt method with U6 snRNA as a housekeeping control.

Huang H., Zhu J., Fan L., Lin Q., Fu D., Wei B, & Wei S. (2019). MicroRNA Profiling of Exosomes Derived from Red Blood Cell Units: Implications in Transfusion-Related Immunomodulation. BioMed Research International, 2019, 2045915.

+ Open protocol

+ Expand

Quantitative PCR Analysis of p23 Protein Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

When the p23KD HeLa cells were about 90% confluence in a 12-well plate, transient transfection was initiated using the EndoFectin reagent as follows: plasmid (6 μg, pGFP²-N2 empty plasmid or cloned pGFP²-N2 plasmid carrying a wild-type p23 or p23 mutant cDNA) and EndoFectin reagent (12 μL) were incubated in a final volume of 100 μL of OPTI-MEM for 20 min before being added onto a well containing 1 mL of fresh media. Media was exchanged after 24 h and cells were harvested 52 h after transfection. Direct-zol kit was used to isolate RNA and reverse transcription was performed with 1 μg of RNA, as estimated by the Fisher Nanodrop Lite (Rockford, IL), using Epicentre MMLV reverse transcriptase. Quantitative PCR was performed with 1 μL of solution after reverse transcription, 10 μL of Bio-Rad iTaq SYBR green supermix (Hercules, CA), and 1 μL (0.8 pmol) of sequence-specific primers (AHR primers are OL615, ACATCACCTACGCCAGTCGC; OL616, TCTATGCCGCTTGGAAGGAT whereas β-actin primers are OL101, CCACACTGTGCCCATCTAGG; OL102, AGGATCTTCATGAGGTAGTCAGTCAG) using a Bio-Rad CFX Connect real-time PCR machine with the following protocol: 40 cycles of 90°C for 10 s/60°C for 1 min with fluorescence readings taken at 60°C. The 2^−ΔΔCq method was used to present the normalized values [26 (link)].

Pappas B., Yang Y., Wang Y., Kim K., Chung H.J., Cheung M., Ngo K., Shinn A, & Chan W.K. (2018). p23 protects the human aryl hydrocarbon receptor from degradation via a heat shock protein 90-independent mechanism. Biochemical pharmacology, 152, 34-44.

+ Open protocol

+ Expand

Quantifying p53 and p21 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using the TRIsure (BIOLINE, UK) reagent according to the manufacturer’s instructions. One microgram of total RNA was subjected to reverse transcription using MMLV reverse transcriptase for 60 min at 37°C (Epicentre Biotechnologies, USA), and the reactions were run on a GeneAmp PCR system 9700 (Applied Biosystems, USA). The following primers were used for RT-PCR: p53 forward: 5′-cagtctgggacagccaagtc-3′ and reverse: 5′-cttctgtacggcggtctctc-3′; p21 forward: 5′-gagagcggcggcagacaacagg-3′ and reverse: 5′-gcgcccaatacgaccaaatc-3′; GAPDH forward: 5′-agccaaaagggtcatcatctc-3′ and reverse: 5′-gtccaccaccctgttgctgtag-3′.

Chan J.Y., Chen Y.C., Liu S.T., Chou W.Y., Ho C.L, & Huang S.M. (2014). Characterization of a new mouse p53 variant: loss-of-function and gain-of-function. Journal of Biomedical Science, 21(1), 40.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!