DNA was extracted from entire PECs and spleens harvested from infected mice using a Qiagen DNeasy Blood & Tissue Kit (Qiagen Sciences). Parasite DNA from 600 ng of PECs and 800 ng of splenic tissue DNA was amplified using primers specific for the T. gondii B1 gene (forward primer GGAACTGCATCCGTTCATG and reverse primer TCTTTAAAGCGTTCGTGGTC) at 20 pmol of each per reaction (Integrated DNA Technologies) by real-time fluorogenic PCR using SsoAdvanced™ Universal IT SYBR® Green SMx (BIO-RAD) on a CFX Connect™ Real-Time System cycler (BIO-RAD). Parasite equivalents were determined by extrapolation from a standard curve.
Ssoadvanced universal it sybr green smx
Manufactured by Bio-Rad
The SsoAdvanced™ Universal IT SYBR® Green SMx is a real-time PCR reagent designed for sensitive and accurate quantification of DNA targets. It contains a proprietary DNA polymerase, optimized buffer, and SYBR® Green I dye for detection of double-stranded DNA amplification.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using ssoadvanced universal it sybr green smx
1
Quantification of T. gondii Parasites
2
Quantifying T. gondii Infection in Mice
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!