Proximity ligation assay was performed as described using the Duolink Starter Kit (Sigma). H1299 cells were transfected and treated as per instructions before overnight incubation with primary antibodies (SRC, SRC pY416, and SRC pY527 [Cell Signaling]; ZsGreen [Clontech]; RASSF1A [Epitomics]; RASSF1C [Abcam]; FLAG tag [Sigma]; and HA tag [Millipore]) and secondary antibodies for 1 hr. Hybridization was performed for 30 min in a humidified chamber, ligation reactions for 30 min, amplification for 100 min, and DAPI was used for cell detection. The dot-like structures were imaged using Zeiss LSM780 microscope using a 63× objective. For each cell, five z stack images were taken and analyzed with BlobFinder V3.2 (Uppsala University) [54 (link)]. The average values, SEM, and significance were calculated using Prism 6.0 (Graphpad) software.
Zsgreen
Manufactured by Takara Bio
ZsGreen is a fluorescent protein derived from the sea anemone Zoanthus sp. It exhibits bright green fluorescence and is commonly used as a reporter or marker in various biological applications.
Automatically generated - may contain errors
Lab products found in correlation
Aria 2 cell sorter, by BD (2 mentions)
Accutase, by Thermo Fisher Scientific (2 mentions)
Zsgreen, by BD (2 mentions)
Flag tag (flag), by Merck Group (1 mentions)
Src py416, by Cell Signaling Technology (1 mentions)
Duolink starter kit, by Merck Group (1 mentions)
Ha tag, by Merck Group (1 mentions)
Lsm 780 microscope, by Zeiss (1 mentions)
Prism 6, by GraphPad (1 mentions)
Facscalibur cytometer, by BD (1 mentions)
6 protocols using zsgreen
1
Proximity Ligation Assay for Protein Interactions
2
RNAseq Analysis of Purified Beta Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNAseq was performed on purified beta cells from 22 donors of normal human cadaveric islets obtained from three sources. Five {three male, two female; age (±SEM) = 45.8 ± 7.0; Body Mass Index (BMI) = 30.6 ± 2.6} were from islets provided by the NIH/NIDDK-supported Integrated Islet Distribution Program (IIDP) (https://iidp.coh.org/overview.aspx ). For these, beta cells were transduced 72 h before harvesting for fluorescence-activated cytometric sorting (FACSAria II) with an adenovirus driven by a RIP1-miniCMV construct that included 177 bases of the hCMV IE-1 promoter ClaI-SpeI fragment ligated to 438 bases of the RIP1 promoter, both upstream of the bright green fluorescent protein ZsGreen (Clontech, Mountain View CA)25 . The beta cell fraction was confirmed to be >92% pure by immunolabeling of sorted cells with insulin, by quantitative reverse transcription PCR (qRT-PCR) and by RNAseq (see below). For ten others, FASTQ files from normal human cadaveric FACS-sorted beta cells labeled using Newport Green were generously provided by Nica et al.24 (link). For the remaining seven, FASTQ files were obtained from Blodgett et al.23 (link).
3
Isolation and Purification of Human Islet β-Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human islets obtained from Prodo Labs were dispersed using Accutase (MT25058CI, Thermo Fisher Scientific) and infected with an adenovirus expressing the bright green fluorescent protein, ZsGreen (Clontech, Mountain View CA) under control of the rat insulin-1 promoter (RIP1) and a mini-CMV enhancer. The RIP1-miniCMV promoter included 177 bases of the hCMV IE-1 promoter ClaI-SpeI fragment ligated to 438 bases of the RIP1 promoter44 (link),45 (link). Following transduction with the Ad.RIP-ZsGreen adenovirus for two hours, RPMI1640 medium containing 10% FBS was added to terminate adenovirus infection. Cells were collected 96 h after infection and loaded onto an Aria II cell sorter (BD biosciences), the live ZsGreen+ cell (β-cells) FITC-positive population was collected. The β-cell fraction was confirmed to be >92% pure by immunolabeling of sorted cells with insulin, and independently, by qRT-PCR and by RNAseq44 (link),45 (link). This procedure was repeated several times using islets from n=3 donors and sorted β-cells were pelleted and frozen at −80°C until enough starting materials for proteomic analyses were obtained. The donors were non-diabetic with BMIs of 26.3, 28.8, and 27 and ages 48, 61 and 63, respectively. Please see Supplementary method for gating strategy.
4
Isolation and Purification of Human Islet β-Cells
5
Characterizing Engineered T Cell Phenotypes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transduction efficiency of human primary T cells was assessed by expression of a reporter gene (ZsGreen, Clontech, Mountain View, CA). The CAIX-Fc protein was expressed from a pcDNA3.1 plasmid that encoded amino acids 38–397 of CAIX followed by human IgG1 hinge, CH2, and CH3 domains; the CAIX signal peptide (aa 1-37) was replaced with Ig leader sequence. Expression of scFv(G250) on transduced T cells was tested by staining the cells with 1 µg CAIX-Fc protein, and then APC-conjugated mouse anti-human IgG antibody (Jackson ImmunoResearch, West Grove, PA). Additionally, expression of the internal rhodopsin nonapeptide (TETSQVAPA) C9 tag of the scFv domain of TCR constructs on transduced T cells was detected by staining with 5 µg mouse 1D4 antibody followed by APC-conjugated goat anti-mouse IgG antibody (Jackson ImmunoResearch). For analysis, the subsets of human cells in culture during clonal expansion experiment were stained with fluorescence conjugated mouse anti-human antibodies (Invitrogen) against CD3 (clone S4.1), CD4 (clone S3.5), or CD8 (clone 3B5). In all cell staining, five hundred thousand cells were stained with antibodies at recommended concentration according to company’s instruction. The matched isotype control antibodies for each sample were used and the cells were analyzed using a FACSCalibur cytometer (Becton-Dickinson, Franklin Lakes, NJ).
6
Lentiviral-Mediated Knockdown of CHK1 in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The shRNA sequence GCAACAGTATTTCGGTATAAT was used to knock down CHK1 (shCHK1-KD), whereas the sequence GCGCGCTTTGTAGGATTCG, which is unrelated to any sequence in humans, served as a negative control (shRNA-NC). The pLVX-shRNA vector system containing either a puromycin resistance cassette or ZsGreen (Clontech Laboratories) was used to carry these sequences. In addition to shRNA-NC, the empty pLVX-shRNA vector was also used as a control (shRNA-Vector). To produce lentiviral particles, all of these plasmids (with two packaging plasmids at a ratio of 4:3:2) were cotransfected into 293T/17 cells via the calcium phosphate precipitation method. Viral infection was performed with 10 µg/ml polybrene, and GFP expression in cells was observed by a fluorescence microscope after 48–72 h. After positive cells were sorted, qPCR and western blotting were performed to detect the knockdown efficiency. Cells with significant target gene knockdown were used for subsequent experiments.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!