Genes were cloned into pRSETA (Life Technologies) using isothermal assembly (Gibson et al. 2009 (link)) with the primers Receptor_setA_for and Receptor_setA_rev for the EpsA receptor and the primers CapA_setA_ITA_for and CapA_setA_ITA_rev for the CapA receptor, which contained overlapping DNA sequences to the MCS of pRSETA. Plasmids were transformed into E. coli BL21. Cells were grown in LB medium at 37°C in the presence of 100 μg/mL ampicillin, and expression of the His6-tagged proteins was stimulated by the addition of 1 mM ITPG during the midexponential phase. Cells were grown for another 4 h at room temperature and then collected by centrifugation at 8000g at 4°C. Cell pellets were resuspended in 20 mL of lysis/binding buffer (50 mM NaH2PO4 at pH 8.0, 150 mM NaCl, 20 mM imidazole, 1 mM PMSF) and disrupted using a cell disruptor. Cell debris was removed with centrifugation at 15,000g for 20 min at 4°C. Supernatant was incubated with Ni-NTA Dynabeads (Life Technologies) overnight at 4°C. Next, the beads were separated from the lysate using a magnet and washed three times with 10 bed volumes of buffer W (50 mM NaH2PO4 at pH 8, 150 mM NaCl, 20 mM imidazole, 1 mM PMSF). The purified protein was eluted from the beads with 500 μL of elution buffer (50 mM NaH2PO4 at pH 8, 150 mM NaCl, 250 mM imidazole). Proteins were dialyzed against buffer containing PBS (pH 7.5).
Prseta
Manufactured by Thermo Fisher Scientific
Sourced in United States, United Kingdom
The PRSETA is a laboratory instrument designed for precise sample preparation and analysis. It offers consistent and reliable performance for a variety of applications.
Automatically generated - may contain errors
Lab products found in correlation
Pgbkt7, by Takara Bio (3 mentions)
Dh5α cells, by Thermo Fisher Scientific (3 mentions)
Pgadt7 ad, by Takara Bio (3 mentions)
Pfn2a flexi vectors, by Thermo Fisher Scientific (3 mentions)
Pgadt7 rec, by Takara Bio (3 mentions)
Hiload 26 60 superdex 75 column, by GE Healthcare (3 mentions)
Pgem t easy, by Promega (2 mentions)
Pgem t easy vector system, by Promega (2 mentions)
Ni nta resin, by Qiagen (2 mentions)
Q5 site directed mutagenesis kit, by New England Biolabs (1 mentions)
Pgem t easy vector, by Promega (1 mentions)
Ni nta agarose bead, by Qiagen (1 mentions)
Bl21 star de3 plyss, by Thermo Fisher Scientific (1 mentions)
Histrap hp column, by GE Healthcare (1 mentions)
Talon resin, by Takara Bio (1 mentions)
Bl21 de3 plyss competent cells, by Merck Group (1 mentions)
Pgex 5x 1, by GE Healthcare (1 mentions)
Pcoldii, by Takara Bio (1 mentions)
Pevol pazf, by Addgene (1 mentions)
Protein assay kit, by Bio-Rad (1 mentions)
51 protocols using prseta
1
Cloning and Purification of His-tagged Receptors
2
Recombinant Expression and Purification of PfHSP90 NTD
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PfCDPK1 and PfCDPK1 T145G proteins were produced using methods described elsewhere (23 (link)). The PfHSP90 N-terminal domain (NTD) comprises the first 223 amino acids of PfHSP90. This region was amplified from the full-length PfHSP90-pRSET-A construct (32 (link)) using the following primers: primer 7, GGCGACGGATCCATGTCAACGGAAACATTCGC; primer 8, GACCCCCTCGAGCTATTCTTCTTCAGATGCGG.
The PCR product was cloned into pRSET-A (Life Technologies) between the BamHI and XhoI sites. Positive clones were confirmed by restriction digestion and sequencing. The clone was transformed intoEscherichia coli Rosetta(pLysS) cells, and protein was expressed by induction with 0.1 mM isopropyl β-d -1-thiogalactopyranoside (IPTG) at 37°C for 2 h. PfHSP90 proteins were purified using Ni-nitrilotriacetic acid (NTA) affinity chromatography (Qiagen) as described in the manufacturer's protocol.
The PCR product was cloned into pRSET-A (Life Technologies) between the BamHI and XhoI sites. Positive clones were confirmed by restriction digestion and sequencing. The clone was transformed into
3
Cloning and Mutagenesis of Pro-FP2 and Pro-FP3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As described earlier pro-enzymes (pro-FP2 and pro-FP3) sequences were amplified from pTOP-pro-FP2 and pTOP-pro-FP3 plasmids, respectively8 ,58 (link). The amplified fragments were digested with BamHI and HindIII (NEB) restriction enzymes for pro-FP2 construct and with BamHI and EcoRI (NEB) restriction enzymes for pro-FP3 construct. The digested fragments were gel extracted and ligated into the expression vector pRSET A (Invitrogen). The sequences of recombinant constructs were confirmed by DNA sequencing. Further, the constructs were transformed into BL21 (DE3) E. coli expression cells (Qiagen). H205L FP3 mutant was designed using Q5 Site-Directed Mutagenesis Kit (NEB) and primers were generated using the NEBaseChangerTM (http://nebasechanger.neb.com ) with H205L FP3 fw: GATAGAATTACTGAACAAAAAAACTAATAGTTTATATAAAAG and H205L FP3 rev: TTTCTGTAATTTTCTGAAAATATTATAAATC. The amplified gene was digested with BamHI and EcoRI restriction enzymes (NEB), ligated into the 6x His-tagged pRSET A expression vector (Invitrogen) and transformed into BL21 (DE3) E. coli cells (Qiagen). The sequence of the mutant construct was confirmed by DNA sequencing.
4
Recombinant Expression of Toxoplasma and Plant Chaperone Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A peptide of Toxoplasma gondii SAG1 (SAG1HC) (from residue 221 to residue 319 of the protein) that encodes both T- and B-cell epitopes [10 (link)] was amplified by PCR using the plasmid pRSET-A-SAG177–322 as a template [21 (link)]. The forward primer sequence was 5′-ggt acc ATA AAG TTC CTC AAG ACA AC-3′ and the reverse primer sequence was 5′-aag ctt CTA AAT GGA AAC GTG ACT GGC-3′ flanked by KpnI and HindIII restriction sites (lowercase), respectively. The N. benthamiana Hsp90.3 full length sequence (NbHsp90.3) was amplified by PCR using the plasmid pRSET-A-NbHsp90.3 as a template [18 (link)]. The forward degenerated primer sequence was 5′-gga tcc ATG GCG GAS GCA GAR ACS TTT GCW TTY CAA GC-3′ and the reverse primer sequence was 5′-ctc gag GTC TAC TTC CTC CAT CTT TTC AGC ATC ATC AGC-3′ flanked by BamHI and XhoI restriction sites (lowercase), respectively. The PCR products were first cloned separately into pGEM-T easy vectors (Promega, Fitchburg, WI, USA). After sequencing, the isolated segments were sequentially cloned into pRSET-A (Invitrogen, Carlsbad, CA, USA) to construct pRSET-A-NbHsp90.3-SAG1HC expression vector.
5
Encoding and Expression of smFPs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA encoding smFPs were ordered from DNA2.0. Genes encoding smFPs were sub-cloned into pRSETa (Life Technologies) for protein expression and purification in Escherichia coli BL21 (this adds an N-terminal His tag for purification, and increases the MW by 4 kDa). Genes encoding smFP variants were sub-cloned into the pCAGGS vector with a CAG promoter (CMV enhancer, β-actin promoter) and regulatory element from the woodchuck hepatitis virus (WPRE)50 (link) for expression in HeLa cells and in utero electroporation51 (link), 52 (link). For expression in flies, R59A05-GAL449 (link) was used to drive expression of UAS-smFP reporter constructs. For expression in mice, GFP and smFP variants were expressed using an adeno-associated virus serotype 2/1 (AAV2/1) driving the probe under control of the human synapsin-1 promoter or a Cre-dependent (FLEX) version of the CAG promoter; live virus was produced (Janelia Farm Viral Vector Core). All constructs were verified by sequencing.
6
Recombinant Leishmania major eIF3E Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The L. major DNA fragment coding for its eIF3e orthologue was amplified by PCR from total genomic DNA flanked by restriction sites for the enzymes BamH I and Xho I (5′ primer - GTG GGA TCC ATG GAC ATG CTA ACG AAG CTG; 3′ primer - TGC TCG AGT TAA CGC ATA ACG GTG TCT AGC TT; restriction sites in italic) and cloned into the same sites of the expression plasmid pRSETa (Life Technologies®). Recombinant L. major EIF3E was expressed with an N-terminal histidine tag in Escherichia coli BL-21star cells (Life Technologies®) followed by purification with Ni-NTA Agarose beads (QIAGEN®) and quantification as previously described
[83 (link)].
[83 (link)].
7
Lasp Construct Synthesis and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All Lasp constructs were synthesized by GenScript or generated by standard cloning procedures. Each construct was then cloned into pP{UASt} (see FlyBase for complete description). For protein production for the cosedimentation assay, L.Lasp was cloned into pRSET-A (Life Technologies) and transformed into Escherichia coli strain BL21. For antibody production, S.Lasp cDNA from Expressed Sequence Tag AT23571 was cloned into pBAD-DEST49 (Life Technologies), expressed, purified, and used for immunization of rats and rabbits according to standard procedures (Cell Imaging and Analysis Network, McGill University). All constructs were verified by sequencing.
8
Purification and Kinase Activity Assay of PRKD1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids expressing His-tagged wild-type and kinase-dead PRKD1 proteins were constructed by digesting plamids HA.PKD (Storz and Toker, 2003 (link)) and HA.PKD.K/W (Storz et al., 2003 (link)) (10808 and 10809; Addgene plasmids), respectively, with BamHI and XhoI and ligating into pRSET A (Life Technologies, Grand Island, NY). To ensure activity of the purified wild-type protein, a 20-µl reaction was set up as follows: 1 µl 32P-γ-ATP (10 mCi), 1 µl 10 µM ATP, 0.2 mM microcystin, 4 µl 5X kinase buffer (23 mM MOPS, 11.5 mM β-glycerphosphate, 23 mM MgCl2, 4.6 mM EGTA, 1.8 mM EDTA, 0.25 mM DTT [pH 7.0]), and 60 nM purifiedHis-PRKD1 diluted in 1X kinase buffer. Reactions were incubated for 30 min at 30°C and stopped using 2X Laemmli Sample Buffer. Autophosphorylation of the wild-type protein was confirmed by immunoblotting with a PRKD1-Ser916 antibody (Cell Signaling Technology). To monitor phosphorylation of USP28, the above reaction was carried out using 10 µM substrate (peptides corresponding to amino acids 543–557 [TCLQRWRSEIEQDIQ] or 892–906 [YSLFRKVSVYLLTGL] in USP28) diluted in 1X kinase buffer. Incorporation of the radiolabel into the peptide was monitored by autoradiography.
9
Purification of CodY-His5 and ScoC proteins
10
Purifying Recombinant (His)6-OsACBP5 Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The (His)6-OsACBP5 recombinant protein was expressed in the soluble fraction of Escherichia coli BL21(DE3) Star pLysS (Invitrogen) cells transformed with plasmid pOS543, derived from vector pRSETA (Life Technologies) following Meng et al. (2011). (His)6-OsACBP5 was purified by using a HisTrap HP column (GE Healthcare) charged with 0.1 M NiCl2 according to Guo et al.117 (link).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!