Genomic DNA from L. acidophilus strains was isolated using a Fungal/Bacterial DNA MiniPrep kit (Zymo Research). Plasmid DNA from E. coli was isolated using a QIAprep Spin Miniprep kit (Qiagen). Restriction enzyme digestions and ligations were performed using Roche restriction enzymes (Roche Diagnostics) and T4 DNA ligase (New England BioLabs), respectively. PCR primers were designed based on the genomic sequence data and synthesized by Integrated DNA Technologies. PCRs were carried out in Bio-Rad MyCycler thermocyclers (Bio-Rad Laboratories) using Choice-Taq Blue DNA polymerase (Denville Scientific) for screening of recombinants and PfuUltra II fusion HS DNA polymerase (Agilent Technologies) for cloning purposes. PCR amplicons were analyzed on 0.8% agarose gels and purified using QIAquick gel extraction kits (Qiagen).
E. coli EC101 cells were made competent using a rubidium chloride competent cell protocol (31 (link)). L. acidophilus cells were prepared for electrotransformation using a modified penicillin treatment protocol (20 (link), 32 (link), 33 (link)).
Choice taq blue dna polymerase
Manufactured by Thomas Scientific
Sourced in United States
Choice-Taq Blue DNA polymerase is a thermostable DNA polymerase enzyme used for DNA amplification in polymerase chain reaction (PCR) applications. It possesses 5'→3' DNA polymerase activity and is capable of synthesizing new DNA strands complementary to a template DNA sequence.
Automatically generated - may contain errors
Lab products found in correlation
Qiaprep spin miniprep kit, by Qiagen (5 mentions)
Qiaquick gel extraction kit, by Qiagen (5 mentions)
T4 dna ligase, by New England Biolabs (4 mentions)
Pfuultra 2 fusion hs dna polymerase, by Agilent Technologies (4 mentions)
Fungal bacterial dna miniprep kit, by Zymo Research (3 mentions)
Restriction enzymes, by Roche (2 mentions)
Mycycler thermocycler, by Bio-Rad (2 mentions)
Zr fungal bacterial dna miniprep kit, by Zymo Research (2 mentions)
Rneasy kit, by Qiagen (1 mentions)
M mlv reverse transcriptase, by Promega (1 mentions)
Q5 high fidelity 2x master mix, by New England Biolabs (1 mentions)
Quick ligase, by New England Biolabs (1 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (1 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
7 protocols using choice taq blue dna polymerase
1
Molecular Techniques for Bacterial DNA Isolation
2
Extraction and Amplification of COL7A1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted with an RNeasy kit (Qiagen, Valencia, CA) and cDNA was synthesized using M‐MLV Reverse Transcriptase (Promega, Madison, WI). PCR analysis was performed in standard PCR conditions (initial denaturation at 94°C for 3 minutes, 35 cycles of 94°C 30 seconds, 60°C 30 seconds and 72°C 30 seconds, and followed by a final extension of 72°C for 3 minutes) with Choice‐Taq Blue DNA Polymerase (Denville Scientific, Inc., Holliston, MA). The following two sets of COL7A1 primers were used for PCR amplifications: F1, TGACCCACGGACAGAGTTCG, R1, GATCAGGATGCAGACCTTGG; F2, GGCTTCTGGGCTTAATGTG, R2, GGGCTGAGTAGTGAAGGAT, as previously reported 24 .
3
Genetic Manipulation of Lactobacillus acidophilus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from L. acidophilus strains was isolated using a Zymo Research Fungal/Bacterial DNA MiniPrep kit (Zymo Research). Plasmid DNA from E. coli was isolated using a QIAprep Spin Miniprep kit (Qiagen). Restriction enzyme digestions and ligations were performed using Roche restriction enzymes (Roche Diagnostics) and T4 DNA ligase (New England Biolabs), respectively. PCR primers (Table 1 ) were designed based on the genomic sequence data and synthesized by Integrated DNA Technologies (Coralville, IA, United States). PCRs were performed in Bio-Rad MyCycler thermocyclers (Bio-Rad Laboratories) using Choice-Taq Blue DNA polymerase (Denville Scientific) for screening of recombinants and PfuUltra II fusion HS DNA polymerase (Agilent Technologies) for cloning. PCR amplicons were analyzed on 0.8% agarose gels and purified using QIAquick Gel Extraction kits (Qiagen).
Escherichia coli EC101 cells were made competent using a rubidium chloride competent cell protocol (Hanahan, 1983 (link)). L. acidophilus cells were prepared for electrotransformation using a modified penicillin treatment protocol (Wei et al., 1995 (link); Walker et al., 1996 (link); Goh et al., 2009 (link)).
All statistical analyses were performed using unpaired student’s t-test. P-values below 0.05 were considered significant.
Escherichia coli EC101 cells were made competent using a rubidium chloride competent cell protocol (Hanahan, 1983 (link)). L. acidophilus cells were prepared for electrotransformation using a modified penicillin treatment protocol (Wei et al., 1995 (link); Walker et al., 1996 (link); Goh et al., 2009 (link)).
All statistical analyses were performed using unpaired student’s t-test. P-values below 0.05 were considered significant.
4
Genomic DNA Isolation and Plasmid Purification from L. acidophilus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from L. acidophilus NCFM and mutants thereof was isolated using the ZR fungal/bacterial DNA MiniPrep kit (Zymo Research). Plasmid DNA was isolated using the QIAprep Spin MiniPrep kit (Qiagen, Hilden, Germany). Restriction enzymes were from Roche (Basel, Switzerland), and T4 DNA ligase was from NEB (New England Biolabs, Ipswich, MA). PfuUltra II fusion HS DNA polymerase (Agilent Technologies, Santa Clara, CA) was used for cloning, and Choice-Taq Blue DNA polymerase (Denville Scientific, South Plainfield, NJ) was used for PCR screening of recombinants. PCR amplicons were analyzed on 0.8% (wt/vol) agarose gels and extracted using the QIAquick gel extraction kit (Qiagen). DNA sequencing was performed by Eton Biosciences (Durham, NC).
5
Genomic and Plasmid DNA Isolation and Cloning
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated using the ZR Fungal/Bacterial DNA MiniPrep Kit (Zymo Research, Irvine, CA, United States). Plasmid DNA was isolated using the QIAprep Spin MiniPrep Kit (Qiagen, Hilden, Germany). Restriction enzymes, Quick Ligase, and Q5 High-Fidelity 2X Master Mix (New England Biolabs, Ipswich, MA, United States) were used for cloning purposes, while Choice Taq Blue DNA polymerase (Denville Scientific, South Plainfield, NJ, South Plainfield) was employed for PCR screening of recombinants. Amplicons were visualized on 1% (wt/vol) agarose gels, then extracted using the QIAquick Gel Extraction Kit (Qiagen). DNA sequencing was performed by Eton Bioscience, Inc. (Research Triangle Park, NC, South Plainfield).
6
RNA Extraction, Reverse Transcription, and PCR Analysis
7
Genomic and Plasmid DNA Isolation and Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from L. acidophilus was isolated using a Zymo Research fungal/bacterial DNA MiniPrep kit. Plasmid DNA from E. coli was isolated using the QIAprep spin miniprep kit (Qiagen). Restriction enzyme digestion was performed using Roche restriction enzymes (Roche Diagnostics). Ligations were performed using T4 DNA ligase (New England BioLabs). PCR primers were designed based on genomic sequence data and synthesized by Integrated DNA Technologies. PCRs were carried out in Bio-Rad MyCycler thermocyclers (Bio-Rad Laboratories) using Choice-Taq Blue DNA polymerase (Denville Scientific) for screening of recombinants and PfuUltra II fusion HS DNA polymerase (Agilent Technologies) for cloning purposes. PCR amplicons were analyzed on 0.8% agarose gels and purified using QIAquick gel extraction kits (Qiagen). DNA sequencing was performed by Eton Bioscience (Durham, NC).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!