Mastercycler ep realplex detection system

Manufactured by Eppendorf

Sourced in Germany

The Mastercycler ep realplex detection system is a thermal cycler designed for real-time quantitative PCR (qPCR) analysis. It allows for precise temperature control and monitoring of DNA amplification in real-time.

Automatically generated - may contain errors

Lab products found in correlation

36 protocols using mastercycler ep realplex detection system

Quantification of Adipogenic Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells or tissues were homogenized in TRIZOL (Thermo Fisher) for extraction of RNA. Reverse transcription and quantitative PCR were carried out using a two-step M-MLV Platinum SYBR Green qPCR SuperMix-UDG kit (Thermo Fisher). Eppendorf Mastercycler ep realplex detection system (Eppendorf, Hamburg, Germany) was used for q-PCR analysis. Primers were obtained from Thermo Fisher. The sequences were: AGGAGATGTTGGAATGACAGG (forward) and CTGAACGCTGAGCGATACATA (reverse) for Adiponectin, CATCAGCGTAAATGGGGATT (forward) and TCGACTTTCCATCCCACTTC (reverse) for FABP-4, GCCAGCCTACGCCACCATAG (forward) and AGCAGAGCCACGGTCATCAAG (reverse) for GLUT4, CAACAGCAGCAGCAGTCTTCC (forward) and CCGAGCCAGTCTCTTCTCTAGG (reverse) for IRS1, and CCGTGAAAAGATGACCCAGA (forward) and TACGACCAGAGGCATACAG (reverse) for β-actin. The amount of each gene was determined and normalized to the amount of β-actin.

Peng K., Pan Y., Li J., Khan Z., Fan M., Yin H., Tong C., Zhao Y., Liang G, & Zheng C. (2016). 11β-Hydroxysteroid Dehydrogenase Type 1(11β-HSD1) mediates insulin resistance through JNK activation in adipocytes. Scientific Reports, 6, 37160.

+ Open protocol

+ Expand

RNA Isolation and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cells and artery tissues using TRIZOL (Thermo Fisher, Carlsbad, CA). Both reverse transcription and quantitative PCR were carried out using a two-step M-MLV Platinum SYBR Green qPCR SuperMix-UDG kit (Thermo Fisher) in Eppendorf Mastercycler ep realplex detection system (Eppendorf, Hamburg, Germany). Primers were obtained from Thermo Fisher (Shanghai, China). Primer sequences are listed in Supplementary Table S1. mRNA levels of target genes was normalized to β-actin.

Wang L., Huang Z., Huang W., Chen X., Shan P., Zhong P., Khan Z., Wang J., Fang Q., Liang G, & Wang Y. (2017). Inhibition of epidermal growth factor receptor attenuates atherosclerosis via decreasing inflammation and oxidative stress. Scientific Reports, 7, 45917.

+ Open protocol

+ Expand

RNA Isolation and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cultured cells and aortic vessels using TRIZOL (Thermo Fisher). Reverse transcription and quantitative PCR was carried out using two-step PrimeScript RT reagent Kit (Perfect Real Time; TAKARA) and Eppendorf Mastercycler ep realplex detection system (Eppendorf, Hamburg, Germany). Primers for genes were synthesized and obtained from Thermo Fisher. Sequences are presented in Supplementary Table 1. mRNA of target genes was normalized to β-actin housekeeping gene.

Lin K., Luo W., Yan J., Shen S., Shen Q., Wang J., Guan X., Wu G., Huang W, & Liang G. (2020). TLR2 regulates angiotensin II-induced vascular remodeling and EndMT through NF-κB signaling. Aging (Albany NY), 13(2), 2553-2574.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells and heart tissues were homogenized in TRIZOL (Invitrogen, Shanghai, China). Both reverse transcription and quantitative PCR (qPCR) were carried out using a two-step M-MLV Platinum SYBR Green qPCR SuperMix-UDG kit (Invitrogen, Shanghai, China). Eppendorf Mastercycler® Ep Realplex detection system (Eppendorf, Hamburg, Germany) was used for qPCR analysis. The primers of target genes are listed in Supporting Information Tables S3 and S4 and were obtained from Invitrogen (Shanghai, China). The amount of each gene was determined and normalized to the amount of β-actin.

Chen X., Qian J., Liang S., Qian J., Luo W., Shi Y., Zhu H., Hu X., Wu G., Li X, & Liang G. (2024). Hyperglycemia activates FGFR1 via TLR4/c-Src pathway to induce inflammatory cardiomyopathy in diabetes. Acta Pharmaceutica Sinica. B, 14(4), 1693-1710.

+ Open protocol

+ Expand

Real-Time qPCR Analysis of Inflammatory Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cells and artery tissues using TRIZOL (Thermo Fisher, Carlsbad, CA) following the manufacturer’s instructions. Reverse transcription was performed using a two-step M-MLV Platinum RT-qPCR Kit (Invitrogen, Carlsbad, CA) and quantitative PCR was performed using SYBR Green qPCR SuperMix-UDG kit (Thermo Fisher) in Eppendorf Mastercycler ep realplex detection system (Eppendorf, Hamburg, Germany). Primer sequences purchased from Thermo Fisher (Shanghai, People’s Republic of China) are summarized in Table 1. The mRNA levels of target genes were normalized using β-actin.Table 1

Primers Used For Real-Time qPCR Assay

Gene	Species	Primers (FW)	Primers (RW)
TNF-α	Mouse	TGATCCGCGACGTGGAA	ACCGCCTGGAGTTCTGGAA
IL-6	Mouse	CCAAGAGGTGAGTGCTTCCC	CTGTTGTTCAGACTCTCTCCCT
ICAM-1	Mouse	GCCTTGGTAGAGGTGACTGAG	GACCGGAGCTGAAAAGTTGTA
VCAM-1	Mouse	TGCCGAGCTAAATTACACATTG	CCTTGTGGAGGGATGTACAGA
β-actin	Mouse	CCGTGAAAAGATGACCCAGA	TACGACCAGAGGCATACAG

Ding X., Zheng L., Yang B., Wang X, & Ying Y. (2019). Luteolin Attenuates Atherosclerosis Via Modulating Signal Transducer And Activator Of Transcription 3-Mediated Inflammatory Response. Drug Design, Development and Therapy, 13, 3899-3911.

+ Open protocol

+ Expand

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells or heart tissues were homogenized in TRIZOL (Thermo Fisher, Shanghai, China). RNA was extracted following the procedure of standard protocol. Reverse transcription and quantitative PCR were carried out using two‐step M‐MLV Platinum SYBR Green qPCR SuperMix‐UDG kit (Thermo Fisher) and Eppendorf Mastercycler ep realplex detection system (Eppendorf, Hamburg, Germany). Primers were synthesized and obtained from Thermo Fisher, Table S1.

You S., Qian J., Sun C., Zhang H., Ye S., Chen T., Xu Z., Wang J., Huang W, & Liang G. (2018). An Aza resveratrol–chalcone derivative 6b protects mice against diabetic cardiomyopathy by alleviating inflammation and oxidative stress. Journal of Cellular and Molecular Medicine, 22(3), 1931-1943.

+ Open protocol

+ Expand

RNA Isolation and Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from cultured H9C2 cells and heart tissue by using TRIZOL (Thermo Fisher Scientific, United States). Reverse transcription and quantitative PCR were carried out using a two-step PrimeScript^TM RT reagent kit (Perfect Real Time) (TAKARA), Eppendorf Mastercycler ep realplex detection system (Eppendorf, Hamburg, Germany) for reverse transcription and QuantStudio3 Real-Time PCR Systems (Applied Biosystems, Thermo Fisher Scientific, United States) for real-time PCR. Primers for the genes were synthesized and obtained from Thermo Fisher Scientific. The primer sequences are presented in Supplementary Table 1. mRNA levels of the target genes were normalized to Actb gene mRNA.

Ye S., Su L., Shan P., Ye B., Wu S., Liang G, & Huang W. (2021). LCZ696 Attenuated Doxorubicin-Induced Chronic Cardiomyopathy Through the TLR2-MyD88 Complex Formation. Frontiers in Cell and Developmental Biology, 9, 654051.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells received the homogenization in TRIZOL (Thermo Fisher). RNA underwent the extraction by complying with normal protocol. Based on Eppendorf Mastercycler eprealplex detection system (Eppendorf, Hamburg, Germany) and two-step M-MLV Platinum SYBR Green qPCR SuperMix- UDG kit (Thermo Fisher), this study conducted reverse transcribing process and quantitatively-related PCR. Primers were purchased from Thermo Fisher (Shanghai, China) (Supplementary Table 1).

Huang S., You S., Qian J., Dai C., Shen S., Wang J., Huang W., Liang G, & Wu G. (2021). Myeloid differentiation 2 deficiency attenuates AngII-induced arterial vascular oxidative stress, inflammation, and remodeling. Aging (Albany NY), 13(3), 4409-4427.

+ Open protocol

+ Expand

Gene Expression Quantification via qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were homogenized in TRIZOL kit (Invitrogen, Carlsbad, CA) for extraction of RNA according to each manufacturer’s protocol. Both reverse transcription and quantitative PCR were carried out using a two-step M-MLV Platinum SYBR Green qPCR SuperMix-UDG kit (Invitrogen). Eppendorf Mastercycler ep realplex detection system (Eppendorf, Hamburg, Germany) was used for quantitative PCR analysis. The primers of genes including TNF-α, IL-6, IL-1β, VCAM-1, ICAM-1, and β-actin were synthesized by Invitrogen. PCR primers were designed using Primer Premier Version 5.0 software (Premier Biosoft, Palo Alto, CA, USA), and sequences were as follows (Invitrogen):

TNF-α sense: 5′-TGGAACTGGCAGAAGAGG-3′;

antisense: 5′-AGACAGAAGAGCGTGGTG-3′.

IL-6 sense: 5′-GAGGATACCACTCCCAACAGACC-3′;

antisense: 5′-AAGTGCATCATCGTTGTTCAT ACA-3′.

IL-1β sense: 5′-ACTCCTTAGTCCTCGGCCA-3′

antisense: 5′-CCATCAGAGGCAAGGAGGAA-3′

β-actin sense: 5′-TGGAATCCTGTGGCATCCATGAAAC-3′;

antisense: 5′-TAAAACGCAGCTCAGTAACAGTCCG-3′.

VCAM-1 sense primer: 5′-TGCCGAGCTAAATTACACATTG-3′;

antisense primer: 5′-CCTTGTGGAGGGATGTACAGA-3′.

ICAM-1 sense primer: 5′-GCCTTGGTAGAGGTGACTGAG-3′;

antisense primer: 5′-GACCGGAGCTGAAAAGTTGTA-3′.

The amount of each gene was determined and normalized by the amount of β-actin.

Xiao S., Zhang W., Chen H., Fang B., Qiu Y., Chen X., Chen L., Shu S., Zhang Y., Zhao Y., Liu Z, & Liang G. (2018). Design, synthesis, and structure–activity relationships of 2-benzylidene-1-indanone derivatives as anti-inflammatory agents for treatment of acute lung injury. Drug Design, Development and Therapy, 12, 887-899.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

According to a standard protocol, H9c2 cells were homogenized in TRIzol^® (Invitrogen; Thermo Fisher Scientific, Inc.) to extract RNA. The two-step M-MLV Platinum SYBR Green qPCR SuperMix- UDG kit (Thermo Fisher Scientific, Inc.) and Eppendorf Mastercycler eprealplex detection system (Eppendorf) were used to conduct RT and qPCR. Reverse transcription was performed at 37°C for 15 min and 85°C for 5 sec, and then maintained at 4°C. The following thermocycling conditions were used for the qPCR: Initial denaturation at 95°C for 3 min; followed by 50 cycles at 95°C for 15 sec and 60°C for 30 sec, and a melting curve stage at 95°C for 15 sec and 60°C for 1 min. The primers were provided by Thermo Fisher Scientific, Inc. and primer sequences are presented in Table SI. The Tm values were normalized to β-actin. The 2^−∆∆Cq method was used to quantify the expression levels (24 (link)).

Huang Y., Zhang J., Xu D., Peng Y., Jin Y, & Zhang L. (2021). SIRT6-specific inhibitor OSS-128167 exacerbates diabetic cardiomyopathy by aggravating inflammation and oxidative stress. Molecular Medicine Reports, 23(5), 367.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!