Site-specific mutagenesis primers for generating CMV-driven human ZFP36C124R or the Eno2 3’UTR ARE deletion (Δ ARE) were designed using Agilent QuickChange Primer Design tool. High fidelity PfuTurbo DNA polymerase was used for PCR amplification per manufacturers instructions, followed by 1-hour DpnI digestion of template DNA, and propagation of mutant plasmid in One Shot Stbl3 Chemically Competent E. coli. See Table 2 for primer sequences used.
Quickchange primer design tool
Manufactured by Agilent Technologies
The QuickChange Primer Design tool is a software application developed by Agilent Technologies that assists users in designing primers for site-directed mutagenesis experiments. The tool provides a streamlined interface for inputting DNA sequences and generating the necessary primers to introduce specific mutations or modifications.
Automatically generated - may contain errors
Lab products found in correlation
Qiaprep spin miniprep kit, by Qiagen (3 mentions)
Quickchange lightning mutagenesis kit, by Agilent Technologies (3 mentions)
Escherichia coli dh5α, by Thermo Fisher Scientific (1 mentions)
Quickchange site directed mutagenesis kit, by Agilent Technologies (1 mentions)
Endofree plasmid maxi kit, by Qiagen (1 mentions)
Fugene hd reagent, by Promega (1 mentions)
Nucleofector system, by Lonza (1 mentions)
Primer 3, by Agilent Technologies (1 mentions)
Wizard plus sv minipreps dna purification kit, by Promega (1 mentions)
Quickchange 2 kit, by Agilent Technologies (1 mentions)
Pfu dna polymerase, by G Biosciences (1 mentions)
S1000 thermal cycler, by Bio-Rad (1 mentions)
Gel pcr dna fragments extraction kit, by IBI Scientific (1 mentions)
Quikchange 2 xl kit, by Agilent Technologies (1 mentions)
Pfu turbo dna polymerase, by Thermo Fisher Scientific (1 mentions)
15 protocols using quickchange primer design tool
1
Site-Specific Mutagenesis of ZFP36 and Eno2 3'UTR
2
SARS-CoV-2 Wuhan-Hu-1 S Plasmid Mutagenesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mutagenesis primers (cagacctggctctcctgtgggagtttgtctgggt/ acccagacaaactcccacaggagagccaggtctg) were designed based on the DNA sequence for SARS-CoV-2 Wuhan-Hu-1 using the QuickChange Primer Design tool (Agilent Technologies, Inc.). Mutagenesis was carried out on a pCDNA-SARs2 Wuhan-Hu 1 S plasmid to create the P681H mutation, using the QuickChange Lightning Mutagenesis kit (Agilent Technologies, Inc.). The original plasmid was generously provided by David Veesler, University of Washington USA. XL-10 gold competent cells were transformed with the mutated plasmid, plated on LB Agar + Ampicillin plates, and left at 37°C overnight. A distinct colony was chosen the next day to grow up a 4 ml small culture at 37°C overnight. pCDNA-SARC-CoV-2 Wuhan-Hu-1 P681H S plasmid was then extracted using the QIAprep Spin Miniprep Kit (Qiagen N.V.) and Sanger sequencing was used to confirm incorporation of the mutation.
3
Mutagenesis of DOR Construct
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The wild-type DOR construct consists of an N-terminal signal sequence FLAG-tag in the pcDNA3.1 vector. All point mutants and deletion mutants were constructed using a modified QuickChange PCR protocol and confirmed via DNA sequencing. Primers for the alanine point mutants and deletion mutants were designed using the QuickChange Primer Design Tool from Agilent Technologies. Following the PCR with PfuTurbo high-fidelity polymerase (Agilent Technologies), a DpnI digest was performed for 1 h, followed by bacterial transformation in Escherichia coli DH5α (Invitrogen). GST fusion protein plasmids were constructed from GST fused to the last 27 amino acids of DOR in the pGEX-4T1 vector. Alanine mutations were introduced into this construct via a QuickChange PCR protocol and confirmed via DNA sequencing.
4
Generating Prdx4 Mutant Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Untagged WT mouse Prdx4 plasmid was obtained from Origene (MC201312). Primers for creating Prdx4 mutants were designed using the QuickChange Primer Design tool (Agilent) and ordered from Integrated DNA Technologies. PRDX4 mutants were created using the QuickChange Site-Directed Mutagenesis Kit (Agilent; 200519). Plasmids were purified using the EndoFree Plasmid Maxi Kit (Qiagen; 12362). All plasmids were validated by Sanger sequencing.
5
Ectopic Expression of LPA1, NEDD4L, and USP11 in Lung Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human LPA1, human NEDD4L, or human USP11 cDNA, and mutants were inserted into pCDNA3.1-V5-His-Topo vector, pCDNA3.1-HA vector, or pCDNA3.1-myc vector. All the primers were designed using Primer3 or QuickChange Primer Design Tool (Agilent Technologies Inc.) software. Over-expression of plasmids in MLE12 cells was performed using the Lonza nucleofector system. Over-expression of plasmids in HBEpCs was performed using FuGENE HD reagent (Promega, Madison, WI).
6
SARS-CoV-2 Spike Protein P681R Mutagenesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primers (ACCTGGCTCTCCTTCGGGAGTTTGTCTGG/CCAGACAAACTCCCGAAGGAGAGCCAGGT) for mutagenesis were designed using the Agilent QuickChange Primer Design tool to create the P681R mutation (CCA->CGA). Mutagenesis was carried out on a pCDNA-SARs2 Wuhan-Hu-1 S plasmid using the Agilent QuickChange Lightning Mutagenesis kit (The original plasmid was generously provided by David Veesler, University of Washington USA). The mutated pcDNA-SARS-CoV-2 Wuhan-Hu-1 P681R S plasmid was used to transform XL-10 gold ultracompetent cells, which were grown up in small culture, and then plasmid was extracted using the Qiagen QIAprep Spin Miniprep Kit. Sanger sequencing was used to confirm the incorporation of the mutation.
7
Cloning and Mutagenesis of SOS1 in pLEX_307
8
SARS-CoV-2 Spike Protein P681H Mutagenesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mutagenesis primers (cagacctggctctcctgtgggagtttgtctgggt/acccagacaaactcccacaggagagccaggtctg) were designed based on the DNA sequence for SARS-CoV-2 Wuhan-Hu-1 using the QuickChange Primer Design tool (Agilent Technologies, Inc.). Mutagenesis was carried out on a pCDNA-SARs2 Wuhan-Hu 1 S plasmid to create the P681H mutation, using the QuickChange Lightning Mutagenesis kit (Agilent Technologies, Inc.). The original plasmid was generously provided by David Veesler, University of Washington USA. XL-10 gold competent cells were transformed with the mutated plasmid, plated on LB Agar + Ampicillin plates, and left at 37°C overnight. A distinct colony was chosen the next day to grow up a 4 ml small culture at 37°C overnight. pCDNA-SARC-CoV-2 Wuhan-Hu-1 P681H S plasmid was then extracted using the QIAprep Spin Miniprep Kit (Qiagen N.V.) and Sanger sequencing was used to confirm incorporation of the mutation.
9
Site-Directed AANATA Mutant Generation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Each site-directed AANATA
mutant was generated by the overlap extension method29 (link) using PfuUltra High-Fidelity DNA polymerase under the following
PCR conditions: initial denaturing step of 95 °C for 2 min, then
30 cycles (95 °C for 30 s, 60 °C for 30 s, and 72 °C
for 1 min), and then a final extension step of 72 °C for 10 min.
Primers for each mutant (Table S1 of theSupporting
Information ) were designed with the Agilent QuickChange Primer
Design tool. The AANATA mutant PCR products were
then inserted into a pET-28a(+) vector using the NdeI and XhoI restriction enzymes. The AANATA mutant pET-28a vectors were transformed into E. coli XL10 competent cells and cultured in LB supplemented
with 40 μg/mL kanamycin at 37 °C. The plasmids were then
purified using the Promega Wizard Plus SV Minipreps DNA purification
kit and sequenced by Eurofins MWG operon. Individual mutant AANATA
proteins were expressed and purified as described previously for the
wild-type enzyme.
mutant was generated by the overlap extension method29 (link) using PfuUltra High-Fidelity DNA polymerase under the following
PCR conditions: initial denaturing step of 95 °C for 2 min, then
30 cycles (95 °C for 30 s, 60 °C for 30 s, and 72 °C
for 1 min), and then a final extension step of 72 °C for 10 min.
Primers for each mutant (Table S1 of the
Information
Design tool. The AANATA mutant PCR products were
then inserted into a pET-28a(+) vector using the NdeI and XhoI restriction enzymes. The AANATA mutant pET-28a vectors were transformed into E. coli XL10 competent cells and cultured in LB supplemented
with 40 μg/mL kanamycin at 37 °C. The plasmids were then
purified using the Promega Wizard Plus SV Minipreps DNA purification
kit and sequenced by Eurofins MWG operon. Individual mutant AANATA
proteins were expressed and purified as described previously for the
wild-type enzyme.
10
Site-Specific Mutagenesis of ZFP36 and Eno2 3'UTR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Site-specific mutagenesis primers for generating CMV-driven human ZFP36C124R or the Eno2 3’UTR ARE deletion (Δ ARE) were designed using Agilent QuickChange Primer Design tool. High fidelity PfuTurbo DNA polymerase was used for PCR amplification per manufacturers instructions, followed by 1-hour DpnI digestion of template DNA, and propagation of mutant plasmid in One Shot Stbl3 Chemically Competent E. coli. See Table 2 for primer sequences used.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!