Abi quantstudio 5 pcr machine

Total RNA was reverse-transcribed into complementary DNA (cDNA) using the RT First Strand cDNA Synthesis Kit (Roche, Basel, Switzerland). Quantitative real-time PCR (qRT-PCR) was performed using 2 × SYBR Green qPCR Master Mix (Servicebio, Wuhan, China) by an ABI QuantStudio 5 PCR machine (Applied Biosystems; Thermo, Waltham, MA, USA) with the following programs: 1 cycle at 95 °C for 10 min, 40 cycles at 95 °C for 15 s and 60 °C for 30 s. The primer sequences are provided in Table 2. Relative mRNA levels of specific genes were quantified using the 2^−ΔΔCt method values with β-actin as the reference gene.

Total RNA was extracted with RNAiso Plus Reagent (TransGen Biotech, China) and reverse-transcribed into complementary DNA (cDNA) using the RT First Strand cDNA Synthesis Kit (Roche, Germany). Quantitative real-time PCR (qRT-PCR) was performed using an ABI QuantStudio 5 PCR machine (Applied Biosystems; Thermo, Waltham, MA, USA) at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 30 s, with 2×SYBR Green qPCR Master Mix (Servicebio, Wuhan, China). The primer sequences are provided in Table 3. Relative mRNA levels of specific genes were quantified using the 2−ΔΔCt method values with respect to the values for β-actin.

Total RNA was extracted from intestine, kidney, and eggshell gland using TransZol Up (TransGen Biotech, China). Then the concentration of the RNA was measured by spectrophotometry (Eppendorf, Germany), and verified the RNA purity by calculating the ratio between the absorbance values at 260 and 280 nm (A260/280 ≈ 1.75–2.01). Next, reverse transcription was performed using total RNA (1 μg) for first-strand cDNA synthesis with the Transcriptor First Strand cDNA Synthesis Kit (Roche, Germany). The cDNA was amplified in a 20 μl PCR reaction system containing 0.2 μmol/L of each specific primer (Sangon, China) and of the SYBR Green master mix (Roche, Germany) according to the manufacturer’s instructions. Real-time PCR was performed at the ABI QuantStudio 5 PCR machine (Applied Biosystems; Thermo, United States), the primers were as follows: chicken NPt2b: forward, ACTGGCTTGCTGTGTTTGC and reverse, AGGGGCATCTTCACCACTTT; NPt2a: forward, CCAAACTGCACGGCTTCT and reverse, TGGGAGGTCAGT GTTGATGA; CaBP-D28k: forward, TGTTATGGAGTGCAGG ATGG and reverse, TAGAGCGAACAAGCAGGTGA; PMCA1b: forward, TTCAGGTACTCATGTGATGGAAGG and reverse, CAGCCCCAAGCAAGGTAAAG; β-actin: forward, CTGGC ACCTAGCACAATGAA and reverse, CTGCTTGCTGATCCA CATCT. Primers against β-actin was used as internal controls, and all of the mRNA values were normalized the differences between individual samples.