Anti pyruvate kinase m2 pkm2

Human ACTR gene of 4275 bp in length was obtained from a mammary gland cDNA library through PCR with the following primers: 5′‐GGGGTACCATGAGTGGATTAGGAGAAAACTTG‐3′ (forward) and 5′‐CCGCTCGAGTCAGCAGTATTTCTGATCAGGACC‐3′ (reverse). Then the products and pcDNA3.0 vector were digested by enzymes KpnI and XhoI. Next, enzyme connection and transformation were accomplished. The recombinant plasmid pcDNA3.0‐Flag‐ACTR was extracted and identified by enzyme digestion and sequencing. The cDNA target sequence of siRNA for ACTR was GGTGAATCGAGACGGAAAC (GenePharma). Anti–ACTR, anti–GPI, anti–PFKL, anti–ENO1 and anti–β‐actin antibodies (Santa Cruz Biotechnology), anti–ALDOA, anti–GLUT1, anti–PGAM1, anti–GAPDH, anti–c‐Myc and anti–PGK1 antibodies (Proteintech), and anti–pyruvate kinase M2 (PKM2) and anti–HK2 antibodies (Cell Signaling Technology) were incubated at appropriate concentrations.