Genomic DNA was extracted using QuickExtract DNA (Epicentre, Madison, WI, USA) following manufacturer's instructions, but using 50uL QuickExtract solution per 100,000 cells and extending the last incubation step at 100 °C to 10 min. The targeted region of CCR5 was PCR-amplified with primers spanning the sgRNA target sites: CCR5 (fw): 5'-GCACAGGGTGGAACAAGATGG-3'; CCR5 (rv): 5'-CACCACCCCAAAGGTGACCGT-3'. The iProof High-Fidelity Master Mix was used for PCR-amplification for 35 cycles (Bio-Rad, Hercules, CA, USA), and the purified PCR products were run on a 1% agarose gel, gel-extracted, and then Sanger-sequenced using both PCR primers. Each sequence chromatogram was analyzed using the TIDE software (http://tide.nki.nl ). Mock-electroporated samples were used as reference sequence and parameters were set to an INDEL size of 30 nucleotides and the decomposition window to cover the largest possible window with high quality traces. For TOPO cloning, gel-purified PCR amplicons were cloned into the TOPO plasmid using the Zero Blunt TOPO PCR Cloning Kit (Life Technologies) according to manufacturer's protocol. TOPO plasmids were transformed into XL-1 Blue competent E.coli, plated on agar plates with kanamycin, and single colonies were sequenced by McLab (South San Francisco, CA, USA) by rolling circle amplification and sequencing using the forward primer used for PCR amplification.
Dna quickextract
Manufactured by Illumina
Sourced in United States
DNA QuickExtract is a reagent system designed to rapidly extract DNA from a variety of sample types, including bacterial, plant, and animal cells. It is a simple, efficient, and streamlined DNA extraction method that can be completed in under 20 minutes.
Automatically generated - may contain errors
Lab products found in correlation
Ampure xp magnetic bead purification kit, by Beckman Coulter (3 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Miniseq, by Illumina (2 mentions)
Q5 high fidelity dna polymerase, by New England Biolabs (2 mentions)
Zero blunt topo pcr cloning kit, by Thermo Fisher Scientific (1 mentions)
Quickextract, by Illumina (1 mentions)
Iproof high fidelity master mix, by Bio-Rad (1 mentions)
M3434 methylcellulose, by STEMCELL (1 mentions)
Hiseq 2500, by Illumina (1 mentions)
Accuprime taq hifi, by Thermo Fisher Scientific (1 mentions)
6 protocols using dna quickextract
1
CCR5 Genetic Modification Protocol
2
Identification of CRISPR-Cas9 Edited Leukemia Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To identify sgRNAs present in leukemia cells, genomic DNA from leukemic cells was harvested using QuickExtract DNA (Epicenter), and sgRNA cassettes were amplified via polymerase chain reaction, using the respective primers (supplemental Table 1 ). Because of the largely clonal nature of transformed leukemia cells, only a limited number of sgRNAs were present; TOPO TA cloning (Qiagen) followed by Sanger sequencing of each individual clone was used to identify the respective sgRNAs. To confirm the clonal nature of the transformed leukemia cells, bulk leukemia cells were plated onto M3434 methylcellulose (Stem Cell Technologies), and each colony was subjected to additional rounds of polymerase chain reaction identification for sgRNAs or edited alleles.
To identify each edited allele, the locus of Tet2, Tet3, or Pbrm1 that was targeted by each sgRNA was firstly amplified using the respective primers (supplemental Table 1 ) and then subjected to Sanger sequencing. The sequencing products were aligned against wild-type alleles to identify the corresponding mutations. Sanger sequencing with multiple peaks was deconvoluted using DECODR.15 (link)
To identify each edited allele, the locus of Tet2, Tet3, or Pbrm1 that was targeted by each sgRNA was firstly amplified using the respective primers (
3
DNA Isolation and Deep Sequencing of APP Locus
4
DNA Isolation and Deep Sequencing of APP Locus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was isolated from cells using DNA QuickExtract (Epicentre, Madison, WI) following treatment by 0.05% trypsin-EDTA and centrifugation. QuickExtract solution was incubated at 65 ºC for 15 min, 68 ºC for 15 min, and then 98 ºC for 10 min. Genomic PCR was performed following manufacturer’s instructions using Q5 High fidelity DNA polymerase (New England Biolabs) and ~500 ng of genomic DNA. Products were then purified using AMPure XP magnetic bead purification kit (Beckman Coulter) and quantified using a Nanodrop2000 or Qubit (Thermo Fisher). For deep sequencing of the APP locus, genomic DNA was amplified using the following primers: TGTCATAGCGACAGTGATCGT and AGCTAAGCCTAATTCTCTCATAGTC. Samples were pooled and run on an Illumina Miniseq with read length of 150bp. Deep sequencing data was analyzed using the Cas-Analyzer software32 (link).
5
Zooplankton Sampling and DNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Specimens were collected by plankton nets with diameter of 20–40 cm and mesh size of 30–50 µm, or rectangular dip nets of same mesh size with width of 0.2–0.3 m, handle length of 0.5–2 m. After collection specimens were in 96% alcohol. Before the start of the genetic studies, each specimen was preliminarily identified by morphological characters37 (link),40 (link),44 (link). The majority of samples are Palearctic but we also included specimens from disjunct Nearctic populations (Mexico and Alaska). DNA was extracted from single adult females using the DNA Quickextract (Epicentre) protocol as modified by Ishida et al.40 (link).
6
Genomic DNA Extraction and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was isolated from cells using DNA QuickExtract (Epicentre, Madison, WI) following treatment by 0.05% trypsin-EDTA and centrifugation. The DNA extract solution was incubated at 65 °C for 15 min, 68 °C for 15 min, and finally 98 °C for 10 min. Genomic PCR was performed following manufacturer’s instructions using AccuPrime HiFi Taq (Life Technologies) and 500 ng of genomic DNA. Products were then purified using AMPure XP magnetic bead purification kit (Beckman Coulter) and quantified using a Nanodrop2000. Primer sequences are listed in Supplementary Tables 3 , 6 , and 7 . Genomic target sequences of predicted off-target sites are listed in Supplementary Table 5 . For deep sequencing, samples were pooled and run on an Illumina HiSeq2500 high throughput at a run length of 2 × 125 bp or an Illumina Miseq 2 × 150 bp.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!