Human podocytes were kindly provided by Prof. Saleem and maintained in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS; Sigma-Aldrich), Insulin-Transferrin-Selenium supplement (ITS; Sigma-Aldrich), 2 mM L-glutamine and antibiotic mixture, as previously reported32 (link). To stimulate cell proliferation, podocytes were cultivated at 33 °C in 5% CO2 (permissive conditions). To induce differentiation, they were maintained at 37 °C in 5% CO2 (non-permissive conditions) for at least 2 weeks. The end of the differentiation process was assessed on the grounds of podocin positivity a well-known component of the slit diaphragm (Fig. 2A ). Cell density was kept below 90% to allow differentiation. Cells were used between passages 7 and 12. To albumin effects, cells were cultured in serum deprivation (1%) starting from 24 hours before stimulation.
Insulin transferrin selenium supplement its
Manufactured by Merck Group
Sourced in United States
Insulin-Transferrin-Selenium supplement (ITS) is a laboratory product that provides a combination of insulin, transferrin, and selenium to cell culture media. It is designed to support cell growth and proliferation in vitro.
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by Merck Group (3 mentions)
Bz 9000 fluorescence microscope, by Keyence (1 mentions)
Penicillin streptomycin, by Merck Group (1 mentions)
Trypsin edta, by Merck Group (1 mentions)
Dmem high glucose, by Merck Group (1 mentions)
Hepes, by Merck Group (1 mentions)
Hepes, by Corning (1 mentions)
Chlorogenic acid, by Merck Group (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Gentamicin, by Merck Group (1 mentions)
5 protocols using insulin transferrin selenium supplement its
1
Human Podocyte Culture Protocol
2
Fluorescent Gb3 Uptake Imaging
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gb3 labeled in the ceramide moiety with the fluorescent tag lissamine rhodamine (LR-Gb3) was custom synthesized by Matreya, LLC according to the method of.
Monti [18 (link)]. 50B11 cells in culture were loaded with LR-Gb3 as previously described for fibroblasts [19 (link)]. Briefly, when cultures were 80%–90% confluent, the culture medium was replaced with serum-free DMEM/F12 supplemented 1% insulin-transferrin‑selenium supplement (ITS, Sigma Chemical Co., St. Louis, MO) and 3.0 nmoles/ml LR-Gb3 complexed with bovine serum albumin. After overnight incubation, the cultures were washed twice with PBS, refed with growth medium, and incubated for an additional 48 h with daily feeding. Live cultures were imaged at 4, 24, and 48 h post-loading using a Keyence BZ-9000 fluorescence microscope with a rhodamine filter set and a 10× objective at standard exposure times.
Monti [18 (link)]. 50B11 cells in culture were loaded with LR-Gb3 as previously described for fibroblasts [19 (link)]. Briefly, when cultures were 80%–90% confluent, the culture medium was replaced with serum-free DMEM/F12 supplemented 1% insulin-transferrin‑selenium supplement (ITS, Sigma Chemical Co., St. Louis, MO) and 3.0 nmoles/ml LR-Gb3 complexed with bovine serum albumin. After overnight incubation, the cultures were washed twice with PBS, refed with growth medium, and incubated for an additional 48 h with daily feeding. Live cultures were imaged at 4, 24, and 48 h post-loading using a Keyence BZ-9000 fluorescence microscope with a rhodamine filter set and a 10× objective at standard exposure times.
3
Cell Culture Protocols for Huh7, U2OS, and AML12
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human cell lines Huh7 and U2OS were cultured in a 37°C incubator with 5% CO2 in DMEM high glucose (Sigma D5796) supplemented with 10% heat-inactivated fetal bovine serum (Sigma F4135), 25 mM HEPES (Sigma H0887), and 1% penicillin/streptomycin (Sigma P4333).
The AML12 mouse hepatocyte cells were cultured in DMEM/F-12 50/50 mix with Lglutamine and 15 mM HEPES (Corning 10–092-CV) supplemented with 10% heat-inactivated fetal bovine serum (Sigma F4135), 1x Insulin-Transferrin-Selenium supplement (ITS) (Sigma I3146, 100x), 40 ng/ml dexamethasone and 1% penicillin/streptomycin (Sigma P4333).
0.25% Trypsin-EDTA (Sigma T4049) was used to passage cells when the confluency reaches approximately 90%. Cells were tested for mycoplasma upon the first thawing and upon generation of new cell lines using a standard PCR protocol with oligos (Forward – 5’ CCGCGGTAATACATAGGTCGC 3’; Reverse – 5’ CACCATCTGTCACTCTGTTAACC 3’).
The AML12 mouse hepatocyte cells were cultured in DMEM/F-12 50/50 mix with Lglutamine and 15 mM HEPES (Corning 10–092-CV) supplemented with 10% heat-inactivated fetal bovine serum (Sigma F4135), 1x Insulin-Transferrin-Selenium supplement (ITS) (Sigma I3146, 100x), 40 ng/ml dexamethasone and 1% penicillin/streptomycin (Sigma P4333).
0.25% Trypsin-EDTA (Sigma T4049) was used to passage cells when the confluency reaches approximately 90%. Cells were tested for mycoplasma upon the first thawing and upon generation of new cell lines using a standard PCR protocol with oligos (Forward – 5’ CCGCGGTAATACATAGGTCGC 3’; Reverse – 5’ CACCATCTGTCACTCTGTTAACC 3’).
4
Blastocyst Cultivation and Electroporation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The blastocysts were washed with culture medium consisting of tissue culture medium 199 with Earle’s salts (TCM 199; Gibco/Invitrogen) supplemented with 20% FBS (Thermo Fisher Scientific),
50 µM chlorogenic acid (Sigma-Aldrich, St. Louis, MO, USA), 1 × insulin-transferrin-selenium supplement (ITS, Sigma-Aldrich) and 50 µg/ml gentamicin (Sigma-Aldrich). The blastocysts were
subsequently incubated individually in 40 µl of culture medium under a layer of mineral oil in an ART Culture Dish 25 (NIPRO, Osaka, Japan) until electroporation and for 24 h after
electroporation. The incubation of the blastocysts was conducted at 38.5ºC in a humidified incubator containing 5% CO2 and 5% O2
50 µM chlorogenic acid (Sigma-Aldrich, St. Louis, MO, USA), 1 × insulin-transferrin-selenium supplement (ITS, Sigma-Aldrich) and 50 µg/ml gentamicin (Sigma-Aldrich). The blastocysts were
subsequently incubated individually in 40 µl of culture medium under a layer of mineral oil in an ART Culture Dish 25 (NIPRO, Osaka, Japan) until electroporation and for 24 h after
electroporation. The incubation of the blastocysts was conducted at 38.5ºC in a humidified incubator containing 5% CO2 and 5% O2
5
Podocyte Differentiation and Glucose-Induced Stress
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human podocytes were kindly provided by Prof. Saleem and maintained in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS; Sigma-Aldrich), Insulin-Transferrin-Selenium supplement (ITS; Sigma-Aldrich), 2 mM L-glutamine and antibiotic mixture, as previously reported [24] . To stimulate cell proliferation, podocytes were cultivated at 33 °C in 5% CO 2 (permissive conditions). To induce differentiation, they were maintained at 37 °C in 5% CO 2 (non-permissive conditions) for at least 2 weeks.
Growth-arrested podocytes were incubated with normal glucose (Control, 5mmol/l) and high glucose (HG,30mmol/l) medium for 72 hours, respectly. The widely used Nrf2 activator, t-BHQ(Tert-Butylhydroquinone,20umol/l) was pretreated for 4 hours to investigate the potential role of Nrf2-ARE pathway. The classical SIRT1 antagonist, nicotinamide (20 mmol/l) was pretreated for 2 hours to study the potential role of SIRT1 in human podocyte incubated with HG. All doses and time of these treatments were determined in our pilot studies.
Growth-arrested podocytes were incubated with normal glucose (Control, 5mmol/l) and high glucose (HG,30mmol/l) medium for 72 hours, respectly. The widely used Nrf2 activator, t-BHQ(Tert-Butylhydroquinone,20umol/l) was pretreated for 4 hours to investigate the potential role of Nrf2-ARE pathway. The classical SIRT1 antagonist, nicotinamide (20 mmol/l) was pretreated for 2 hours to study the potential role of SIRT1 in human podocyte incubated with HG. All doses and time of these treatments were determined in our pilot studies.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!