ChIP assay was performed with an EZ-ChIP chromatin immunoprecipitation (ChIP) assay kit (17-295, Millipore) according to the manufacturer’s recommended procedure. The monoclonal antibodies for H3K9Me2 and nonspecific immunoglobulin G (56834, Sigma-Aldrich) were used for each sample. The amplified PCR products were electrophoresed with a 2% agarose gel.
Ez chip chromatin immunoprecipitation chip assay kit
Manufactured by Merck Group
The EZ-ChIP chromatin immunoprecipitation (ChIP) assay kit is a laboratory tool used to study protein-DNA interactions. It allows for the isolation and analysis of DNA fragments associated with specific proteins within a cell. The kit provides the necessary reagents and protocols to perform the ChIP procedure.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using ez chip chromatin immunoprecipitation chip assay kit
1
Chromatin Immunoprecipitation Assay
2
ChIP Assay for Tgfbr2 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP was performed using a commercially available EZ-ChIP Chromatin Immunoprecipitation (ChIP) Assay Kit (Millipore) according to manufacturer's instructions. DNA-bound protein was immunoprecipitated using both anti-YAP (ab71153, Abcam) and IgG (Abcam) as a negative control. For quantification of coprecipitated DNA, samples were then subjected to amplification by employing primers (Forward primer: GAGGCTATTTGGGGGTGTGT and reverse primer: TCAACTTCAGCATTCCCCCG) which amplified the promoter region (186 bp) of the Tgfbr2 promoter.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!