Log In Sign up
The largest database of trusted experimental protocols

Phtn halotag cmv neo

Manufactured by Promega
Visit Supplier

The PHTN HaloTag CMV-neo is a laboratory equipment product designed for molecular biology applications. It serves as a protein-labeling system, allowing the covalent attachment of fluorescent or affinity-based ligands to HaloTag fusion proteins. This facilitates visualization, enrichment, and downstream analysis of the target proteins.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions) Nanobret nano glo detection system kit, by Promega (1 mentions) Pnlf1 n cmv hygro, by Promega (1 mentions) Gateway lr reaction, by Thermo Fisher Scientific (1 mentions) P3000 reagent, by Thermo Fisher Scientific (1 mentions) Dual glo assay system, by Promega (1 mentions)

3 protocols using phtn halotag cmv neo

1

Construction of retroviral expression vectors

Check if the same lab product or an alternative is used in the 5 most similar protocols
The retroviral transfer vector pMIGR1, in which the internal ribosomal entry site sequence has been removed, has been previously described (41 (link)). Full length p84 cDNA was amplified with primers inserting SacII and NotI restriction sites (forward primer TTCCCCGCGGATGGAGAGCTCAGATGTGGAG; reverse primer TTTTCCTTTTGCGGCCGCTTATTGGATTATGCCAGAGAATG) and subcloned into pHTN HaloTag CMV-neo (Promega). A HaloTag p84 PCR product was then generated with a 5’ HpaI restriction site (forward primer AATTAAAATGTTAACATGGCAGAAATCGGTACTG), digested with HpaI and NotI and subcloned into pMIGR1. Full length p101 cDNA was amplified with primers inserting 5’ and 3’ EagI restriction sites (forward primer GATACGGCCGAGGCATGCAGCCAGCAGCCACAAC, reverse primer AACGCGGCCGCCTAGGGCAGAG) and subcloned into pMIGR1-GFP. Both pMIGR1-HaloTag p84 and pMIGR1-GFP p101 were sequenced to confirm the correct orientation and absence of mutations.
Rynkiewicz N.K., Anderson K.E., Suire S., Collins D.M., Karanasios E., Vadas O., Williams R., Oxley D., Clark J., Stephens L.R, & Hawkins P.T. (2020). Gβγ is a direct regulator of endogenous p101/p110γ and p84/p110γ PI3Kγ complexes in mouse neutrophils. Science signaling, 13(656), eaaz4003.
+ Open protocol
+ Expand
2

Protein-Protein Interaction Analysis via NanoBRET

Check if the same lab product or an alternative is used in the 5 most similar protocols
An attR1-ccdB-attR2 cassette (from pBWH) was generated by PCR and cloned into the NotI site of pHTN HaloTag® CMV-neo (Promega) by Gibson assembly to generate pHTNW. An attR1-ccdB-attR2 cassette (from pAWH) was generated by PCR and cloned into the NotI site of pNLF1-N [CMV/Hygro] (Promega) by gibson, to give pNLF1W. Indicated ORFs were cloned into either pHTNW or pNLF1W by Gateway LR reaction (Thermo Fisher Scientific) following the manufacturer’s indications. HEK293T cells were plated in 24-well plates at a density of 1.4 × 105 cells per well. Cells were transfected with 500 ng of pHTNW-ORF, 5 ng of pNLF1W-ORF, 0.75 μl of Lipofectamine 3000 and 1 μl of P3000 Reagent (Thermo Fisher Scientific). After 20 h, each transformation was re-plated in four wells of 96-well plates at a density of 1 × 104 cells per well for duplicate control and experimental samples (technical replicates), and PPIs were analysed with NanoBRET™ Nano-Glo® Detection System kit (Promega) following manufacturer’s instructions. Each transformation experiment was performed at least twice. The corrected NanoBRET ratio was calculated according to the manufacturer’s instructions.
Yang J.S., Garriga-Canut M., Link N., Carolis C., Broadbent K., Beltran-Sastre V., Serrano L, & Maurer S.P. (2018). rec-YnH enables simultaneous many-by-many detection of direct protein–protein and protein–RNA interactions. Nature Communications, 9, 3747.
+ Open protocol
+ Expand
3

Measuring SRE-Driven Transcription

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293T cells seeded in 12-wells plates coated with poly-D-lysine were transfected with 500 ng of empty vector pHTN HaloTag CMV-neo (Promega G7721) or pCEFL-HaloTag-P-Rex1 constructs and co-transfected with 500 ng of SRE-firefly luciferase and 50 ng of Renilla luciferase plasmids. Thirty-six hours after transfection, the cells were serum-starved overnight and then luminescence signal was measured using Dual-Glo assay system (Promega E2920) according to the manufacturer’s instructions. Firefly-luminescence reads were normalized with Renilla-luminescence signal and adjusted to the negative control.
Ravala S.K., Adame-Garcia S.R., Li S., Chen C.L., Cianfrocco M.A., Gutkind J.S., Cash J.N, & Tesmer J.J. (2024). Structural and dynamic changes in P-Rex1 upon activation by PIP3 and inhibition by IP4. bioRxiv.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!