Sv96 kit

shRNA targeting hPDX1 and hFGFR1 were prepared by inserting the following oligonucleotides into pLKO.1-puro and pLKO.1-DsRed, respectively: 5′ CCGGTGACCG AGAGACACAT CAACTCGAGT TGATGTGTCT CTCGGTCATT TTTG-3′ (into the target sequence reported as sihuPDX1 in a previous report38 (link)) and 5′ CCGGGATGGC ACCCGAGGCA TTATTCTCGA GAATAATGCC TCGGGTGCCA TCTTTTTG-3′ (commercially available from Sigma-Aldrich as a validated sequence). The viruses were prepared as previously reported39 (link).
The hIveNry cells were infected before differentiation for 1 h in suspension and with shaking. They were then added to the medium and incubated for 1 day, before the medium was changed to human iPS medium. One or two days after, the infected hiPS cells were differentiated to PPs according to the current protocol. At day 10 or 11 after the differentiation, 1000 DsRed-positive cells were sorted into 10 μL FCP lysate (Qiagen) or total RNA was extracted from whole cells using a SV 96 kit (Promega) and subjected to quantitative real-time PCR as described below.

RNA was collected with a Promega SV96 kit and complementary DNA (cDNA) was produced with a Bio-Rad iScript RT Supermix according to the manufacturers’ protocols. cDNA was stored in 10 mM Tris–HCl (pH 8.0), 0.1 mM EDTA buffer at −20°C until use. Ribogreen and SYBR green nucleic acid binding dyes were used to quantify RNA and cDNA, respectively. The qualities of RNA and cDNA samples were determined by measuring the A₂₆₀/A₂₈₀ ratios. Three samples per group were assayed, each containing 75 ng cDNA. A TaqMan gene expression assay was used to perform qPCR, and amplification products were analyzed using a CFX Connect qPCR system (Bio-Rad). The primer/probe sequences were as follows: RTF primer, TCTGGACGTGCCAGTGTGAA; RTR primer, TGCTCCCTGAGGACACATCA for ERBB2 (accession number NG007503); luciferase probe set Mr03987587 (Thermo Fisher) for firefly luciferase (accession number AF093683). Unless otherwise indicated, data were analyzed using the ΔΔC_q method.

RNA was extracted using an SV RNA kit and SV96 kit (Promega, Madison, WI, USA). For cDNA synthesis, we used ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, Osaka, Japan) and analysed the results with Gene Ace SYBR qPCR Mix (Nippon Gene, Tokyo, Japan) on a Light Cycler 480 thermal cycler (Roche, Basel, Switzerland). The expression level of each gene was normalised to that of GAPDH using the delta-delta CT method and expressed as arbitrary units. The primers used are listed in Supplementary Table S1. For the sorted samples, we also used a FastLane Cell cDNA kit (Qiagen, Dusseldorf, Germany). We sorted 50 target cells in each tube containing 5 μL FCP lysis buffer and, after following the manufacturer’s protocol to remove genomic DNA, performed the reverse transcription procedure. Real-time PCR was performed using the Gene Ace SYBR qPCR Mix.