Pcmv n flag vector

MiR-483-5p mimics and the miR-483-5p inhibitor were purchased from Sigma-Aldrich. We used mirVana miRNA mimic or mirVana miRNA inhibitor (Ambion, Austin, TX, USA) for the negative control. Furthermore, a RBM5 expression vector was generated into a pCMV-N-FLAG vector (Beyotime, Jiangsu, China) and pCMV-N-FLAG vector for the negative control. Cells were allowed to reach 70% to 80% confluence in 6-well plates before transfection. Cells were transfected using Lipofectamine²⁰⁰⁰ according to the manufacturer's instructions. After 48 hours of transfection, the cells were harvested for further study.

Indicated siRNA, vectors and miR-573 mimics/antagomir transfections were carried out using Lipofectamine 2000 according to the manufacturer's protocol and each sequence is listed in Supplementary Table 1. Non-specific negative control siRNAs were also used (sense strand: 5′-UUCUCCGAACGUGUCACG-3′; anti-sense strand: 5′-ACGUGACACGUUCGGAGAATT-3′). The mock group was defined as the one supplemented with the transfection reagent only.
The wild-type and mutants FGFR1 3′-UTR were generated on the miR-573 target recognition sites (seed sequences) as shown in Supplementary Table S1. Both the wild-type and mutated 3′-UTRs of FGFR1 gene were cloned into the pmirGLO dual luciferase reporter vector using Sac I and Xba I restriction sites. Furthermore, a GATA3 expression vector was generated into a pCMV-N-flag vector (Beyotime, Jiangsu, China) using ECoR I and Xba I restriction sites. A 2,000-bp fragment of the miR-573 promoter region was PCR amplified from the genomic DNA of HEK293T cell line using primers in Supplementary Table S2. The PCR product was cloned into a pGL3 luciferase reporter (Promega Corp, Madison, WI, USA) and the resulting vector was named miR573-pGL3-pro. FGFR1 expression vector was bought from Addgene company and all these vector products were validated by sequencing.

The complete PIM1 protein coding sequence (NCBI reference sequence NM_001243186.1) was subcloned into the pCMV‐N‐myc vector (Beyotime, China). The complete RUNX3 cDNA sequence (NCBI reference sequence NM_004350.2) was subcloned into the pCMV‐N‐FLAG vector (Beyotime, China). A mutant RUNX3(RUNX3(4A)) construct was generated by introducing site‐specific mutations into the complete RUNX3 coding sequence (pCMV‐N‐FLAG vector), by substituting Ser149, Thr151, Thr153 and Thr155 into alanine, under the guidance of PCR‐based site‐directed mutagenesis kit (Vazyme, China).
Primers to generate coding sequence of PIM1:

Forward primer, 5′‐CCCAAGCTTATGCTCTTGTCCAAAATCAACTCGC‐3′,

Reversed primer, 5′‐CGGAATTCCTATTTGCTGGGCCCCGGC‐3′;

Primers to generate coding sequence of RUNX3:

Forward primer, 5′‐CCCAAGCTTATGCGTATTCCCGTAGACCCAAG‐3′,

Reversed primer, 5′‐CGGAATTCTCAGTAGGGCCGCCACACG‐3′;

Primers to generate RUNX3 (4A) were designed following the instruction:

Forward primer, 5′‐GGCTTTCGCCCTGGCCATCGCTGTGTTCACCAACCCCACCCAA‐3′, reversed primer, 5′‐GCGATGGCCAGGGCGAAAGCCTTCCCTCGCCCACTGCGG‐3′.