Platinum pcr supermix high fidelity

Manufactured by Thermo Fisher Scientific

Sourced in United States

Platinum PCR SuperMix High Fidelity is a ready-to-use, high-performance PCR master mix designed for high-fidelity DNA amplification. It contains a high-fidelity DNA polymerase and all the necessary components for efficient and accurate PCR amplification.

Automatically generated - may contain errors

Lab products found in correlation

Rneasy mini kit, by Qiagen (7 mentions) Autogen flexigene, by Qiagen (5 mentions) Dneasy blood and tissue kit, by Qiagen (4 mentions) Qiaquick gel extraction kit, by Qiagen (4 mentions) Iscript rt kit, by Bio-Rad (4 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (3 mentions) Ion plus fragment library kit, by Thermo Fisher Scientific (3 mentions) Pgem t easy vector, by Promega (2 mentions) Miseq reagent kit v2, by Illumina (2 mentions) Qiaquick pcr purification kit, by Qiagen (2 mentions) Bigdye terminator v1.1 cycle sequencing kit, by Thermo Fisher Scientific (2 mentions) Agencourt ampure xp bead, by Beckman Coulter (2 mentions) Ion library quantitation kit, by Thermo Fisher Scientific (2 mentions) Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (2 mentions) Simpliamp thermal cycler, by Thermo Fisher Scientific (2 mentions) Dna clean concentrator, by Zymo Research (2 mentions) Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (2 mentions) Ampure xp, by Beckman Coulter (2 mentions) Icycler, by Bio-Rad (2 mentions) Q5 high fidelity 2x master mix, by New England Biolabs (2 mentions)

Spelling variants of this product

Platinum PCR SuperMix (144 citations) PCR SuperMix (56 citations) Platinum PCR SuperMix High Fidelity kit (22 citations) PCR SuperMix High Fidelity (16 citations) Platinum High Fidelity Supermix (3 citations) Platinum PCR SuperMix High Fidelity Enzyme Mix (2 citations)

92 protocols using platinum pcr supermix high fidelity

Cloning of miR-888 Binding Sites

Check if the same lab product or an alternative is used in the 5 most similar protocols

An approximately 500-bp region surrounding each of the four miR-888 binding sites in the PR 3′UTR was amplified from ECC-1 genomic DNA using the Platinum PCR SuperMix, High Fidelity (Life Technologies; primer sequences in Table S5). PCR products were purified using the PCR Purification Kit (Qiagen, Valencia, CA) and subcloned into the pGEM-T Easy vector (Promega, Madison, WI). Insert sequences were subsequently cloned into the psiCHECK2 vector and transformed into TOP10 OneShot competent E. coli (Life Technologies).
An approximately 500-bp region surrounding each of the four miR-888 binding sites in the PR 3′UTR was amplified from ECC-1 genomic DNA using the Platinum PCR SuperMix, High Fidelity (Life Technologies; primer sequences in Table S5). PCR products were purified using the PCR Purification Kit (Qiagen, Valencia, CA) and subcloned into the pGEM-T Easy vector (Promega, Madison, WI). Insert sequences were subsequently cloned into the psiCHECK2 vector and transformed into TOP10 OneShot competent E. coli (Life Technologies).

Hovey A.M., Devor E.J., Breheny P.J., Mott S.L., Dai D., Thiel K.W, & Leslie K.K. (2015). miR-888: A Novel Cancer-Testis Antigen that Targets the Progesterone Receptor in Endometrial Cancer. Translational Oncology, 8(2), 85-96.

+ Open protocol

+ Expand

Sanger Sequencing Sample Preparation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR reactions to prepare samples for Sanger sequencing were performed according to Platinum® PCR SuperMix High Fidelity (Invitrogen; Thermo Fisher Scientific, Inc.) manufacturer's instructions. Briefly, a total volume of 20 µl was used, containing 18 µl of Platinum® PCR SuperMix High Fidelity (Invitrogen; Thermo Fisher Scientific, Inc.), 0.2 µM of forward (5′-AATGATAGGCGGACTCCCAG-3′) and reverse (5′-GAGGCTTGCCTTCTTCCGAT-3′) primers. High quality genomic DNA (5–50 ng) extracted from peripheral blood cells was added to the PCR mix and the PCR reactions were performed in a Veriti™ 96-Well Thermal Cycler (Thermo Fisher Scientific, Inc.). The cycling conditions employed were initial denaturation at 94°C, 2 min, 30 cycles of amplification at 94°C, 15 sec, 55°C, 15 sec, 68°C, 1 min and held at 10°C. The size and quantity of each fragment analyzed was evaluated with the electrophoresis system Agilent 2200 TapeStation System (Agilent Technologies, Inc.) using the kit DNA ScreenTape and Reagents (Agilent Technologies, Inc.) according to manufacturer's instructions. Each sample was sequenced with both forward and reverse primers in an Applied Biosystems 3130 Genetic Analyzer (Thermo Fisher Scientific, Inc.) according to manufacturer's instructions.

Lourenço R.A., Lança M., Monteiro Gil O., Cardoso J., Lourenço T., Pereira-Leal J.B., Rodrigues A.S., Rueff J, & Nunes Silva S. (2023). BRCA1 VUS: A functional analysis to differentiate pathogenic from benign variants identified in clinical diagnostic panels for breast cancer. Molecular Medicine Reports, 28(1), 136.

+ Open protocol

+ Expand

Determination of IDH1 Mutation by PCR-RFLP

Check if the same lab product or an alternative is used in the 5 most similar protocols

IDH1 gene mutation in tumor tissue was determined by PCR‐RFLP (Polymerase Chain Reaction‐Restriction Fragment Length Polymorphism), using BclI restriction enzyme (New England Biolabs). Exon 4 of IDH1 gene was amplified using 100 ng of DNA in a final volume of 25 μl. The amplification mix had 15 pmol of each primer (forward 5′‐GATGGGTAAAACCTATCATCATTGA ‐3′, reverse 5′‐TGTGTTGAGATGGACGCCTA‐ 3′; Meyer et al., 2010), and 20 μl of Platinum ^® PCR Supermix High Fidelity (Life technologies) containing polymerase, salts, magnesium, and dNTPs. Amplification was performed with a 55°C annealing temperature for 40 cycles. PCR products were digested in a final volume of 20 μl during 2 hr at 50°C; digestion products were subject to electrophoresis using an 8% polyacrylamide gel.

Veganzones S., de la Orden V., Requejo L., Mediero B., González M.L., del Prado N., Rodríguez García C., Gutiérrez‐González R., Pérez‐Zamarrón A., Martínez A., Maestro M.L., Zimman H.M., González‐Neira A., Vaquero J, & Rodríguez‐Boto G. (2017). Genetic alterations of IDH1 and Vegf in brain tumors. Brain and Behavior, 7(9), e00718.

+ Open protocol

+ Expand

16S rRNA Gene Amplification and Sequencing

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR amplification of two variable (V1-V2) regions (349 bp) of the 16S RNA gene was carried out using primers 5’-AGR GTT YGA TYM TGG CTC AG-3’ and 5’-TGC TGC CTC CCG TAG GAG T-3’ (Microsynth AG, Switzerland), where “R” could be A or G, “Y” could be C or T, “M” could be A or C [30 (link)]. Platinum PCR Super Mix High Fidelity (Life Technologies) was used, according to the manufacturer’s recommendations, with a no template sample as a negative control. PCR products were purified by MinElute PCR Purification Kit (Qiagen) and quantified using Qubit (Life Technologies). Sequencing libraries were prepared with the TruSeq ChIP Sample Prep Kit (Illumina) starting from 10 ng of PCR-amplified DNA and checked by Qubit and Fragment Analyzer (Agilent) before loading the sequencing cell. Multiplexed (S1 Table) high-throughput sequencing was performed at the Ecole Polytechnique Fédérale de Lausanne on a MiSeq instrument (Illumina), with MiSeq Reagent kit V2 500 cycles (Illumina), where libraries were diluted to 8 pM and pooled according to the origin of the sputum samples. PhiX (PhiX Control V3, Illumina) was spiked in (15%) to generate diversity in the sequencing clusters.

Sala C., Benjak A., Goletti D., Banu S., Mazza-Stadler J., Jaton K., Busso P., Remm S., Leleu M., Rougemont J., Palmieri F., Cuzzi G., Butera O., Vanini V., Kabir S., Rahman S.M., Nicod L, & Cole S.T. (2020). Multicenter analysis of sputum microbiota in tuberculosis patients. PLoS ONE, 15(10), e0240250.

+ Open protocol

+ Expand

mtDNA COI Sequence Amplification and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The mtDNA COI gene was amplified from 83 individuals (Kenya, South Africa, Madagascar, Mauritius and Balearic Islands) [GenBank numbers: KT339684- KT339742; KT945260-KT945271; KT968152- KT968163] using primer pair Bc1 Culic Fm (GTA AAA CGA CGG CCA GTT CWA CWA AYC AYA AAR WTA) and JerR2m (CAG GAA ACA GCT ATG ACC CAA ARA ATC ARA AYA RRT GTT G) [32 (link)]. The amplification was carried out under the following conditions: Initial denaturation of 94 °C for 2 min, 40 cycles of 94 °C for 30 s, 50 °C for 30 s, 72 °C for 1 min and a final elongation step of 72 °C for 5 min. Each 25 μl PCR reaction included 1.0 μl template DNA (20 ng), 0.2 μmol each of forward and reverse primer, 18 μl Platinum PCR supermix high fidelity (Life Technologies) and 2.75 μl de-ionized water. The PCR amplicons were purified using QIAquick PCR purification kit (Qiagen) and 20 μl was sequenced using the Sanger sequencing method (Macrogen, Geumchun-gu, Seoul).

Onyango M.G., Michuki G.N., Ogugo M., Venter G.J., Miranda M.A., Elissa N., Djikeng A., Kemp S., Walker P.J, & Duchemin J.B. (2015). Delineation of the population genetic structure of Culicoides imicola in East and South Africa. Parasites & Vectors, 8, 660.

+ Open protocol

+ Expand

Microsatellite DNA Genotyping Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

A total of 143 individuals (Table 1) were genotyped at 12 microsatellite DNA loci (Table 2). Each 25 μl PCR reaction included 1.0 μl template DNA (20 ng), 0.2 μmol (each) forward and reverse fluorescent labelled primer (Applied Biosystems, USA), 18 μl Platinum PCR supermix high fidelity (Life Technologies) and 2.75 μl de-ionized water (Life Technologies). The amplification was carried out under the following conditions: initial denaturation of 94 °C for 3 min, then 14 cycles of 94 °C for 30 s, 59 °C for 30 s with a gradient decrease of 1 °C/cycle, 72 °C for 30 s followed by 30 cycles of 94 °C for 30 s, 46 °C for 30 s, 72 °C for 30 s and a final elongation step of 72 °C for 7 min. Amplified PCR products were fragment-sized by an external contractor (Macrogen, Geumchun-gu, Seoul). The fragment lengths were analysed and corrected manually using Peak Scanner v2.0 (Applied Biosystems). A fraction (5 %) of the original samples was re-run as a validation of initial allelic scores.

+ Open protocol

+ Expand

Total RNA Extraction and cDNA Synthesis from ARPE-19 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was prepared from cultured ARPE-19 cells, using Qiagen’s RNeasy Mini Kit according to the manufacturer’s instructions, and cDNA was synthesized using the SuperScript III First Strand Synthesis System for RT-PCR kit (Life Technologies). In a total volume of 20μl, 1μg of total RNA was incubated with 200U SuperScript III reverse transcriptase and 0.5μg Oligo(dT)_12-18 primer, at 50°C for 50min. Heating to 85°C for 10min stopped the reaction, and 1μl first-strand product was amplified in 25μl Platinum PCR SuperMix High Fidelity (Life Technologies) plus 10pmol forward and backward primers. After 35 cycles (denaturation at 94°C for 30sec, annealing at 55°C for 40sec, extension at 72°C for 2min, and a final extension at 72°C for 5min after the last cycle) of amplification on a PTC-200 Pettier Thermal Cycler (MJ Research, Waltham, MA), 10μl of PCR product was separated in a 1% agarose gel, and stained with ethidium bromide.

Wang L., Cano M, & Handa J.T. (2014). p62 Provides Dual Cytoprotection Against Oxidative Stress in the Retinal Pigment Epithelium. Biochimica et biophysica acta, 1843(7), 1248-1258.

+ Open protocol

+ Expand

Peripheral Blood RNA Extraction and RT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from peripheral blood was extracted using the NucleoSpin RNA Blood kit (Takara, Shiga, Japan) and reverse transcribed to cDNA using High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems). PCR was performed using Platinum PCR SuperMix High Fidelity (Life Technologies) with primer pairs listed in Table S1. The PCR products were separated on a 2% agarose gel.

Hirotsu Y., Nakagomi H., Sakamoto I., Amemiya K., Oyama T., Mochizuki H, & Omata M. (2015). Multigene panel analysis identified germline mutations of DNA repair genes in breast and ovarian cancer. Molecular Genetics & Genomic Medicine, 3(5), 459-466.

+ Open protocol

+ Expand

Exome Capture Library Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was prepared for exome capture according to the protocol included with the Ion Xpress Plus Fragment Library Kit for the AB Library Builder (Life Technologies, Carlsbad, CA) using the AB Library Builder System (Applied Biosystems, Foster City, CA). The DNA solvent was exchanged with pure water by ethanol precipitation. Enzymatic shearing was performed using 1–2 μg genomic DNA per sample. Sheared DNA was purified using the Agencourt AMPure XP Reagent (Agencourt, Boston, MA) with a target size peak of 350 bp, followed by adaptor ligation (A1 and P1). The adaptor-ligated genomic DNA fragments were then eluted in 45 μL of low TE buffer and amplified by PCR using 200 μL of Platinum PCR Supermix High Fidelity (Life Technologies), 5 μL of 50 μM library amplification primer mix, and 45 μL ligated DNA. The thermal cycling protocol was initial denaturation at 95°C for 5 min, followed by 7–8 cycles at 95°C for 15 s, 58°C for 15 s, and 72°C for 60 s. The amplified library was purified and eluted in 50 μL of low TE buffer using AMPure XP Reagent.

Motoike I.N., Matsumoto M., Danjoh I., Katsuoka F., Kojima K., Nariai N., Sato Y., Yamaguchi-Kabata Y., Ito S., Kudo H., Nishijima I., Nishikawa S., Pan X., Saito R., Saito S., Saito T., Shirota M., Tsuda K., Yokozawa J., Igarashi K., Minegishi N., Tanabe O., Fuse N., Nagasaki M., Kinoshita K., Yasuda J, & Yamamoto M. (2014). Validation of multiple single nucleotide variation calls by additional exome analysis with a semiconductor sequencer to supplement data of whole-genome sequencing of a human population. BMC Genomics, 15(1), 673.

+ Open protocol

+ Expand

Whole Genome Amplification Quality Evaluation

Check if the same lab product or an alternative is used in the 5 most similar protocols

To evaluate the quality of the whole genome amplified DNA, the products of the previous amplification (together with the negative control) were used as templates to PCR amplify a 600 bp housekeeper gene (actin). Each 20 μL reaction included 1 μL template DNA (approximately 20 ng), BSA (400 ng/μL), 5 μm each forward and reverse primer (Act-2 F and Act-8R) [18 (link)] and 15 μL Platinum PCR supermix high fidelity (Life Technologies). The cycling profile was 94 °C for 2 min, 35 cycles of 94 °C for 30 s, 58 °C for 30 s, 72 °C for 30 s and a final elongation at 72 °C for 5 min [18 (link)]. The PCR products were assessed for size by electrophoresis as described earlier.

Onyango M.G., Beebe N.W., Gopurenko D., Bellis G., Nicholas A., Ogugo M., Djikeng A., Kemp S., Walker P.J, & Duchemin J.B. (2015). Assessment of population genetic structure in the arbovirus vector midge, Culicoides brevitarsis (Diptera: Ceratopogonidae), using multi-locus DNA microsatellites. Veterinary Research, 46, 108.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!