Cytokine mRNA measurement following stimulation of cells and skin was performed by qRT-PCR. Total RNA was prepared from cells lysate using TRIzol (Invitrogen, Carlsbad, CA) as per manufacturer instructions. Contaminating genomic DNA was removed with TurboDNase (Ambion, Austin, TX). Subsequently RNA (1 μg/mL) was reverse transcribed into cDNA using high capacity cDNA Reverse Transcription Kit (Applied Biosystem, Foster City, CA) as per manufacturer recommendation. The qRT-PCR reactions were conducted in 1X Universal master mix (Applied Biosystem, Foster city, CA) with 1/20 volume cDNA/reaction for individual gene expression assays, in a Viia7 Real-time PCR system (Applied Biosystem, Foster city, CA). Custom-made human specific TaqMan® Micro Fluidic Cards containing panels of 96 gene expression assays were loaded with a sample volume of cDNA solution equivalent to 250 ng of the original RNA, mixed with 2x Universal Master Mix (ThermoFisher, Carlsbad, CA) The Ct values obtained for each gene were directly normalized to housekeeping values (GAPDH or 18S) in order to obtain ΔCt. Change in the expression levels of mRNA in stimulated cultures were indicated as fold increase over media treated cells using 2−ΔΔCt.
Universal master mix
Manufactured by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Denmark
Universal Master Mix is a pre-formulated reagent solution designed for use in various real-time PCR applications. It contains the necessary components for DNA amplification and detection, allowing for efficient and reliable gene expression analysis.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (13 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (11 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (10 mentions)
Viia 7 real time pcr system, by Thermo Fisher Scientific (9 mentions)
Trizol, by Thermo Fisher Scientific (9 mentions)
High capacity cdna archive kit, by Thermo Fisher Scientific (8 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (7 mentions)
Trizol reagent, by Thermo Fisher Scientific (7 mentions)
Taqman probe, by Thermo Fisher Scientific (7 mentions)
Gapdh, by Thermo Fisher Scientific (7 mentions)
7300 real time pcr system, by Thermo Fisher Scientific (6 mentions)
7900ht real time pcr system, by Thermo Fisher Scientific (5 mentions)
Rneasy plus mini kit, by Qiagen (5 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (5 mentions)
Abi prism 7900ht sequence detection system, by Thermo Fisher Scientific (5 mentions)
Taqman reverse transcription reagents kit, by Thermo Fisher Scientific (5 mentions)
Power sybr green pcr master mix, by Bio-Rad (4 mentions)
Tripure isolation reagent, by Roche (4 mentions)
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Universal probe library, by Roche (3 mentions)
122 protocols using universal master mix
1
Quantification of Cytokine mRNA Expression
2
Multiplex Real-Time PCR Assay for Pathogen Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The multiplex real-time PCR assay was developed using the Life Technology ABI 7500 System platform and the standard chemistry. The concentrations of primers and probes for each target gene were adjusted to achieve optimal amplification condition. The reaction mixture contains 12.5 μl of 2 × Universal Master Mix (Life Technology), 200 nM forward and reverse primers, appropriate concentrations of four probes [(Z3276 (80 nM), stx1 (80 nM), stx2 (20 nM), and IAC (40 nM)] and 2 μl of template DNA. Water was added to make a final reaction volume of 25 μl. The amplification conditions for the multiplex assay were set as follows: activation of TaqMan at 95 °C for 10 min, then 40 cycles of denaturation at 95 °C for 10 s and annealing/extension at 60 °C for 60 s.
To compare the efficiency of the multiplex assay with simplex assay, each of the target genes Z3276, stx1, and stx2 was amplified by three individual simplex assays. For the simplex assays, three individual reaction mixtures each contains 12.5 μl of 2 × Universal Master Mix (Life Technology), corresponding forward and reverse primers (200 nM) and probe (100 nM). An equal amount of template DNA (2 μl) was used for the simplex assays, and water was added to make a final reaction volume of 25 μl. The amplification conditions for simplex assays were the same as the multiplex assay.
To compare the efficiency of the multiplex assay with simplex assay, each of the target genes Z3276, stx1, and stx2 was amplified by three individual simplex assays. For the simplex assays, three individual reaction mixtures each contains 12.5 μl of 2 × Universal Master Mix (Life Technology), corresponding forward and reverse primers (200 nM) and probe (100 nM). An equal amount of template DNA (2 μl) was used for the simplex assays, and water was added to make a final reaction volume of 25 μl. The amplification conditions for simplex assays were the same as the multiplex assay.
3
Screening miRNA Expression Profiles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
miRNA expression pattern was determined by Low Density Arrays (TaqMan® array Human MicroRNA card A and B v3.0) (Life Technologies) that allow the screening of 754 miRNAs. miRNAs were reverse transcribed from 800 ng of total RNA using Megaplex™ Primer Pools, Human Pools A and B v3.0 and TaqMan® MicroRNA Reverse Transcription kit (Life Technologies). After adding the Universal Master Mix (Life Technologies), cDNA was loaded on the arrays in a volume of 100 µL per port. For validation, 800 ng of total RNA were again reverse transcribed applying RT primers specific for the studied miRNAs and using snRNA U6 and RNU48 as endogenous controls in a triplex approach. cDNA quantification was performed using Universal Master Mix (Life Technologies) and TaqMan®MicroRNA individual assays for miR-15a and miR-16-1 (ID 000389 and ID 000391, respectively), snRNA U6 (ID 001973) and RNU48 (ID 001006) (Life Technologies) in singleplex PCR reactions.
All described qRT-PCR reactions were performed on an ABI Prism 7900HT (Life Technologies). Relative expression was calculated using the 2−ΔΔCt quantification method58 (link), which allows the final result to be presented as the fold change of target gene expression in a target sample relative to a reference sample, normalized to a reference gene.
All described qRT-PCR reactions were performed on an ABI Prism 7900HT (Life Technologies). Relative expression was calculated using the 2−ΔΔCt quantification method58 (link), which allows the final result to be presented as the fold change of target gene expression in a target sample relative to a reference sample, normalized to a reference gene.
4
Genotyping of IL-17A and IL-17F SNPs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The IL-17A (G197A) and IL-17F (T7488C) SNPs were selected from SNP500 Cancer project and previous litera-tures19 (link)–21 (link) and genotyped using a TaqMan allelic discrimination assay.22 (link) For each sample, 5 ng of DNA per reaction was used with 12.5 µL of 2X Universal Master Mix and 200 nM of primers (Thermo Fisher Scientific). All genotypes were determined by end point reading using a ViiA™ 7 real-time PCR System (Thermo Fisher Scientific). Five percent of the samples were randomly selected and subjected to repeat analysis as a measure for verification of genotyping procedures. The results were reproducible without any discrepancies.
5
RNA Extraction and qPCR Analysis of Brain Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using the RNeasy Mini Kit (QIAGEN, Valencia, CA). cDNA was prepared from individual brain samples using the WT-Ovation™ RNA Amplification System (NuGEN Technologies, Inc., San Carlos, CA). QPCR was conducted using TaqMan chemistry and using probes from the Universal Probe Library (Roche Diagnostics, Indianapolis, IN) and primers designed with the online ProbeFinder software (https://lifescience.roche.com/en_us/brands/universal-probe-library.html ). In the PCR reaction, 5 μl of cDNA obtained as previously described was combined with 10 μl of 2X Universal Master Mix (Thermo Fisher Scientific, Waltham, MA), 0.2 μl of each forward and reverse primers at 200 nM, 0.2 μl of probe at 100 nM, and RNAse/DNAase-free water. All reactions were performed in duplicate and were run in a 7500 real-time PCR system (Thermo Fisher Scientific). Data were normalized using glyceraldehyde-3-phosphate dehydrogenase (GAPDH). For immunohistochemical analysis, formalin-fixed blocks were used to construct tissue microarrays with three punches (diameter of 1 mm) from each block. Five-micrometer sections were cut and immunohistochemistry performed using a rabbit polyclonal anti-C3c complement antibody (1:3000, DakoCytomation) and either mouse anti-GFAP or anti-CD68 as the primary reagents and diaminobenzidine or amino ethyl carbazole as the chromogens.
6
Quantification of Leptin Receptor Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated and purified using affinity chromatography (79306; Qiazol and 74104, RNeasy Mini Kit, Qiagen, Valencia, CA, USA) following the manufacturer’s protocol. Quantitative
real-time PCR assays were used to measure the Ob-R. Total RNA (2 μg) was reverse transcribed using Super Script II (18064022; Invitrogen, Carlsbad, CA, USA), and cDNA (150
ng) was amplified using 2x Universal Master Mix (4440038; Applied Biosystems, Foster City, CA, USA). The oligonucleotide primers for Ob-R were designed to detect all
Ob-R isoforms [21 (link)]: forward GTGCTGGCCATCAATTCAATT; reverse GGGTGACAGCATCCAGGAA; probe carboxyfluorescein-CAGCAAAGTAAATATCG-minor
groove binding dye. Reactions were performed in triplicate on an ABI 7000 Thermocycler using standard thermocycling conditions (Applied Biosystems): 1 cycle at 50°C for 2 min (Uracil
N-glycosylase activation), 1 cycle at 95°C for 10 min (DNA polymerase activation) followed by 40 cycles at 95°C for 15 sec (denaturation) and 60°C for 1 min (annealing and extension). TaqMan
Ribosomal RNA control reagents (4308329; Applied Biosystems) were used to detect 18s ribosomal RNA. Ob-R data were analyzed by the standard curve method prepared by serial
dilution of the standard plasmid containing a homologous sequence for Ob-R.
real-time PCR assays were used to measure the Ob-R. Total RNA (2 μg) was reverse transcribed using Super Script II (18064022; Invitrogen, Carlsbad, CA, USA), and cDNA (150
ng) was amplified using 2x Universal Master Mix (4440038; Applied Biosystems, Foster City, CA, USA). The oligonucleotide primers for Ob-R were designed to detect all
Ob-R isoforms [21 (link)]: forward GTGCTGGCCATCAATTCAATT; reverse GGGTGACAGCATCCAGGAA; probe carboxyfluorescein-CAGCAAAGTAAATATCG-minor
groove binding dye. Reactions were performed in triplicate on an ABI 7000 Thermocycler using standard thermocycling conditions (Applied Biosystems): 1 cycle at 50°C for 2 min (Uracil
N-glycosylase activation), 1 cycle at 95°C for 10 min (DNA polymerase activation) followed by 40 cycles at 95°C for 15 sec (denaturation) and 60°C for 1 min (annealing and extension). TaqMan
Ribosomal RNA control reagents (4308329; Applied Biosystems) were used to detect 18s ribosomal RNA. Ob-R data were analyzed by the standard curve method prepared by serial
dilution of the standard plasmid containing a homologous sequence for Ob-R.
7
CTLA-4 SNPs Genotyping Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Three CTLA-4 SNPs were selected: CTLA-4 −658C > T(rs11571317), +49A > G (rs231775) and CT60 G > A (rs3087243) were genotyped using TaqMan allelic discrimination assay following the previously described protocol [44 (link)]. TaqMan CTLA-4 SNP Genotyping Assays having catalogue number 4351379 and assay numbers 4351379 C___3296043_10 (rs3087243), 4351379 C__30981396_10 (rs11571317) and 4351379 C___2415786_20 (rs231775) were acquired from Applied Biosystems. These assays were supplied at 40X concentration. For each PCR, a 5 ng DNA sample was used with 10 μL of 2X Universal Master Mix and 1X assay mix in a total 20 μL reaction volume (Applied Biosystems, Foster City, CA, USA). PCR conditions were pre-read stage 60 °C for 30 s, hold stage 95 °C for 10 min, PCR stage 95 °C for 15 s and 60 °C for 1 min for 40 cycles, and post-read stage at 60 °C for 30 s. All genotypes were determined using end-point reading on the ViiATM 7 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). VIC and FAM were used as a probes for the alleles [VIC/FAM]: rs11571317 [C/T], rs231775 [A/G] and rs3087243 [A/G].
For quality control, 5 % of the samples were selected randomly and repeated analysis were performed for verification procedures. The results were reproducible without any inconsistencies.
For quality control, 5 % of the samples were selected randomly and repeated analysis were performed for verification procedures. The results were reproducible without any inconsistencies.
8
Quantitative Detection of Viral DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nucleic acid isolation was performed with a MagNA Pure LC total nucleic acid or DNA isolation kit for serum (TTV) or whole blood (EBV and CMV) using a standardized protocol, according to the instructions (Roche Diagnostics, Mannheim, Germany). Input/output volume was set to 200/100 µL, and the sample was eluted in extraction buffer. The TTV-DNA levels were determined using a 7300 real-time PCR system (Applied Biosystems, Foster City, CA). Each PCR reaction contained 2 µL of extracted total nucleic acid, 10 µL of 2X Universal Master Mix (Applied Biosystems, Foster City, CA), 0.5 µL and 20 µM of forward and reverse primer, respectively, 0.3 µL and 20 µM of BHQ hydrolysis probe, and 2 µL of RNase-free H2O. The reaction conditions were 50°C for 2 minutes and 95°C for 10 minutes prior to 45 cycles at 95°C for 15 seconds and 60°C for 60 seconds. The assay range was determined by serial dilution of plasmids with an insert of a synthesized sequence matching the TTV PCR product, and quantification was obtained from a plot of Ct values. CMV- and EBV-DNA levels were determined using a method described previously with minor modifications [27 (link)]. All primer and probe sequences are listed in Supplementary Table 1 . For EBV and CMV quantification, a control sample consisting of unrelated Phocine herpesvirus 1 (PhHV-1) was included prior to nucleic acid extraction.
9
Genotyping of TNF-α SNPs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of three important TNF-α SNPs were selected from the SNP500 Cancer project and previous literature [24 (link)–26 (link)]. SNPs were genotyped using TaqMan allelic discrimination assay as previously described [27 (link)]. TaqMan TNF-α SNP Genotyping Assays having catalogue number 4351379 and assay numbers C_11918223_10 (rs1799724), C_7514879_10 (rs1800629), and C_2215707_10 (rs361525) were acquired from Applied Biosystems. These assays were supplied at 40X concentration. For each PCR, a 5-ng DNA sample was used with 12.5 μL of 2X Universal Master Mix and 1X assay mix in a total of 25 μL reaction volume (Applied Biosystems, Foster City, CA, USA). PCR conditions are as follows: pre-read stage 60 °C for 30 s, hold stage 95 °C for 10 min, PCR stage 95 °C for 15 s and 60 °C for 1 min for 40 cycles, and post-read stage 60 °C for 30 s. All genotypes were determined by endpoint reading on ViiA™ 7 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). For quality control, 5 % of the samples were randomly selected and subjected to repeat analysis as measure for verification of genotyping procedures. The results were reproducible without any discrepancies.
10
Quantifying Porcine Cell Phenotypes
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!