Mettl3

Cervical cancer or adjacent non-tumor cervical tissues were embedded in O.C.T. compound (Leica Microsystems, Bannockburn, IL, USA) and 10-μm sections were cut using cryostat. Prior to immunofluorescence staining, slides were fixed with methanol for 20 min. After washing with PBS three times, slides were permeabilized in Triton X-100 for 15 min and incubated with METTL3 (1:500, Abcam) and RAGE (1:50, Abcam) primary antibodies overnight at 4°C. Slides were washed with PBS three times and incubated with secondary antibodies (goat anti-rabbit Alexa Fluor 488 or goat anti-mouse Alexa Fluor 594, 1:200 dilution, Life Technologies) for 1 h. Tissue sections were mounted in Vectashield mounting medium containing 4′,6-diamidino-2-phenylindole (DAPI; Vector Laboratories, Burlingame, CA, USA), imaged with fluorescent microscopy (Leica Microsystems), and prepared by a Zeiss LSM image browser software.

Western blot analysis was performed as described previously,³¹ The following are used as the primary antibodies: METTL3 (1:1000; Abcam, Cambridge, UK), N‐cadherin (1:10 000; Abcam, Cambridge, UK), αSMA (1:500; Sigma‐Aldrich Corp), ZO‐1 (1:500; Invitrogen, Carlsbad, CA, US), MMP9 (1:500; Abcam, Cambridge, UK), pGSK3β (phospho Ser9) (1:1000, Immunoway Biotechnology, Plano, US), GSK3β (1:1000, Immunoway Biotechnology, Plano, US), cyclinD1 (1:1000, Immunoway Biotechnology, Plano, US), β‐catenin (1:1000, Cell Signaling Technology), β‐actin (1:1000, Cell Signaling Technology) ，β‐tubulin (1:1000, Cell Signaling Technology) and GAPDH (1:1000; Cell Signaling Technology). The following were used as secondary antibodies: goat anti‐rabbit IgG H&L (HRP) pre‐adsorbed antibody (1:5000; Abcam, Cambridge, UK) and goat anti‐mouse IgG H&L (HRP) pre‐adsorbed antibody (1:5000; Abcam, Cambridge, UK).

These assays were conducted as described previously.²¹ The primer sequences of reverse transcription‐quantitative polymerase chain reaction (RT‐qPCR) were as follows: METTL3_F: CAAGCTGCACTTCAGACGAA and METTL3_R: GCTTGGCGTGTGGTCTTT; PI3K_F: TCTGTCACCAATCCCAAG and PI3K_ R: TGAGCACCTCTGAAACAA; AKT_ F: CACGATACCGGCAAAGAA and AKT_R: AGGGCTGCTCAAGAAGGA; mTOR_F: TCCGAGAGATGAGTCAAGAGG and mTOR_R: CACCTTCCACTCCTATGAGGC; P70S6K_ F: TTGAGTCATCTGGGCTGT and P70S6K_ R: AAATGCTGCTTCTCGTCT; 4EBP1_ F: GGTGTTCACGAAGAGGAGGG and 4EBP1_R: ATACTGGGCAGGCGTTGG; and GAPDH_F: TGGACCTGACTTGCCGTCTA and GAPDH_ R: CCCTGTTGCTGTAGCCAAATT. The primary antibodies were as follows: METTL3 (ab195352, 1:1000; Abcam, UK, London), p‐PI3K‐p85α (Tyr607) (AP0153, 1:500; Bioworld, China, Beijing), p‐AKT (S473) (CST, USA, New York, #4058, 1:1000), p‐mTOR (Ser2448) (CST, USA, New York, #5536, 1:1000), p‐P70S6K (Ser371) (CST, USA, New York, #9208, 1:1000), p‐4EBP1 (Ser65 + Thr70) (Bioss, China, Beijing, bs‐3720R, 1:500), β‐Tubulin (Bioworld, China, Beijing, AP0064, 1:2000), and GAPDH (Bioworld, China, Beijing 1:5000). The secondary antibody was AffiniPure goat anti‐rabbit IgG (H + L) (Jackson ImmunoResearch Inc, USA, New York).

Total protein extracts were isolated with RIPA lysis buffer in the presence of a protease inhibitor mixture and phosphatase inhibitor cocktail (SIGMA). Protein extracts were quantified with the BCA Protein Assay Kit (Pierce). Equal amounts of total cellular lysates (30 μg) were separated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE), transferred to nitrocellulose membrane, analyzed by immunoblotting with the appropriate antibodies and then revealed by ECL (GE Healthcare). The antibodies used were as follows: ADAR1 (Santa Cruz Biotechnology), ADAR1 (Bethyl), CDK2 (Santa Cruz Biotechnology), YTHDF1 (Abcam), METTL3 (Abcam), METTL14 (Bethyl), cyclinE (Santa Cruz Biotechnology), p57 (Santa Cruz Biotechnology), Skp2 (Santa Cruz Biotechnology), CDC14B (LifeSpan), ADAR2 (Santa Cruz Biotechnology), Ubiquitin (Thermo Fisher), β-actin (Santa Cruz Biotechnology), GAPDH (Cell Signaling), and the anti-rabbit and anti-mouse peroxidase-conjugated secondary antibodies (Santa Cruz Biotechnology).

Total cellular proteins were extracted using a total protein extraction kit (Beyotime, China). Cell lysates were separated by 10% SDS-PAGE gel electrophoresis and transferred to a nitrocellulose membrane. The membranes were blocked with 5% nonfat milk and incubated with the primary antibodies and then incubated with species-specific secondary antibodies. The following antibodies were used at the indicated concentrations METTL3 (1:1000, Abcam, USA), GAPDH (1:1000, CST, USA).