Ccg 1423

The rat cardiomyocyte cell H9C2 (CRL-1446, ATCC, United States) was maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) at 37°C in a 5% CO₂ incubator. Expression constructs for Sp1 (Sun et al., 2013 (link)) and PDE5A (Zhang et al., 2008 (link)) have been described previously. Small interfering RNA sequence for MRTF-A is UGGAGCUGGUGGAGAAGAA. Transient transfection was performed with Lipofectamine 2000 (Invitrogen, United States). Cells were harvested 48 h after transfection. Angiotensin II was purchased from Sigma (United States). CCG-1423 was purchased from Selleck (China). H9C2 were seeded at 1 × 10⁵ cells/p35 culture dish and starved in serum-free DMEM overnight. Angiotensin II (1 μM) was added the next day for another 12 or 24 h as previously described (Kuwahara et al., 2010 (link)). In certain experiments, CCG-1423 (10 μM) was added together with Ang II as previously described (Yu et al., 2018 (link)).

Human breast cancer cells (MCF7 and T47D) were obtained from and authenticated by the Chinese Academy of Sciences Type Culture Collection Cell Bank and were maintained in DMEM (Invitrogen) as previously described (Chen et al., 2020b (link)). Human recombinant TGF-β was purchased from R&D. CCG-1423 was purchased from Selleck. Stable cells were generated as previously described (Chen et al., 2020a ). FLAG-tagged KDM7A (Lee et al., 2018 (link)) and Myc-tagged MKL1 (Wu T. et al., 2020 (link)) have been previously described. Small interfering RNA sequences were purchased from Dharmacon: for human MKL1, GUGUCUUGGUGUAGUGU; for human KDM7A#1, UGAACAUGCCUUUGAAAUUUU; for human KDM7A#2: CTTTGAGGCTTCAAGAGAGCCTCAAAG; for human SMAD2, GUCCCAUGAAAAGACUUAA; for human SMAD3, GGAGAAAUGGUGCGAGAAG; and for human SMAD4, GUACUUCAUACCAUGCCGA. Transient transfections were performed with Lipofectamine 2000 (Invitrogen). Luciferase activities were assayed 24–48 h after transfection using a luciferase reporter assay system (Promega) as previously described (Chen et al., 2020a ,c (link); Li et al., 2020a (link)).

All animal experiments were reviewed and approved by the Intramural Ethics Committee on Humane Treatment of Experimental Animals. All mice were bred at the Nanjing Biomedical Research Institute of Nanjing University (NBRI). Endothelial-specific deletion of MKL1 was achieved by crossing the Mkl1^f/f strain^{23 (link)} to the Cdh5-Cre strain^{34 (link)}. Liver fibrosis was induced by bile duct ligation (BDL) or CCl₄ injection (1.0 mL/kg body weight as 50%, vol/vol, weekly for 6 weeks)^{20 (link)}. In certain experiments, the mice were injected peritoneally the MKL1 inhibitor CCG-1423 (1 mg/kg, Selleck), the STAT3 inhibitor C188-9 (50 mg/kg, Selleck), or the TWIST1 inhibitor harmine (10 mg/kg, Selleck) daily after the BDL procedure.

Simvastatin is an inhibitor of HMGCR, which is the rate-limiting enzyme of the mevalonate pathway. Previously, it has been reported that statins exhibit antitumor efficacy [24 (link), 25 (link)]. Prior to experimental use, Simvastatin (Selleck, USA, S1792 ) was activated with a solution containing EtOH and NaOH as per provided directions, and was used to treat HOS and MG63 cells at doses of 4 µM and 8 µM respectively (Additional file 1: Figure S1c). The RhoA inhibitor CCG-1423 (Selleck, USA, S7719) and mevalonic acid lithium salt (MedChemExpress, NJ, USA, HY-113,071 A) were used to treat cells at concentrations of 5 µM and 200 mM, respectively (Additional file 1: Figure S1d, e).

Human melanoma cell lines (A375P, A375SM) were obtained from the Korean Cell Line Bank (KCLB, Seoul, Korea). The A375P cell was maintained in DMEM supplemented with 10% (v/v) fetal bovine serum (FBS), 1% (v/v) L-glutamine and penicillin–streptomycin. A375SM was maintained in MEM supplemented with 10% (v/v) FBS and 1% (v/v) L-glutamine and penicillin–streptomycin. All cells were cultured in a 37 °C, 5% CO₂ humidified incubator. NecroX-5 (Enzo Life Sciences, Farmingdale, NY, USA), ZCL278, NSC23766, and CCG-1423 (Selleck Chemicals, Houston, TX, USA) were dissolved in dimethyl sulfoxide (DMSO) for each condition and dose. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and DMSO were purchased from Sigma–Aldrich (St. Louis, MO, USA).