Lncrna cdna synthesis kit

Total RNA was extracted with TRNzol Universal reagent (Tiangen, Beijing, China). The A260/A280 ratio of purified RNA was typically between 1.8 and 2.4 and the yield between 80µg and 120µg. RNA samples were stored at -80°C. RNA integrity was assessed by gel electrophoresis.
RNA was reverse transcribed into cDNA with lncRNA cDNA Synthesis Kit (Tiangen, Beijing, China). LncRNA qPCR Detection Kit (Tiangen, Beijing, China) was applied to examine the expression of SNHG5 on a 7500 PCR System (Applied Biosystems, USA) in accordance with manufacturer's instructions. Each reaction contained 2×lnR lncRNA Premix (25 µl), 50×ROX Reference Dye (1 µl), Forward Primer (1.25 µl), Reverse Primer (1.25 µl), RNA template (2 µl) and RNase-Free ddH2O (19.5 µl). The cycling condition is as follows: Stage 1: 42°C for 20 min, 95°C for 3 min,1 Cycle; Stage 2: 94°C for 30 sec, 60°C for 30 sec, 72°C for 30 sec, 40 Cycles; Stage 3: 72°C for 50 min. SNHG5's forward primer was 5'- CGCTTGGTTAAAACCTGACACT -3' and its reverse primer was 5'- CCAAGACAATCTGGCCTCTATC -3'. Relative expression level of SNHG5 was calculated using 2^-ΔΔCT method after normalization with reference gene (GAPDH).