Lncrna cdna synthesis kit
The LncRNA cDNA Synthesis Kit is a laboratory product designed to facilitate the conversion of long non-coding RNA (lncRNA) into complementary DNA (cDNA) for further analysis and downstream applications. The kit provides the necessary reagents and protocols to perform this process efficiently.
2 protocols using lncrna cdna synthesis kit
RNA Extraction and Gene Expression Analysis
SNHG5 Expression Profiling by qPCR
RNA was reverse transcribed into cDNA with lncRNA cDNA Synthesis Kit (Tiangen, Beijing, China). LncRNA qPCR Detection Kit (Tiangen, Beijing, China) was applied to examine the expression of SNHG5 on a 7500 PCR System (Applied Biosystems, USA) in accordance with manufacturer's instructions. Each reaction contained 2×lnR lncRNA Premix (25 µl), 50×ROX Reference Dye (1 µl), Forward Primer (1.25 µl), Reverse Primer (1.25 µl), RNA template (2 µl) and RNase-Free ddH2O (19.5 µl). The cycling condition is as follows: Stage 1: 42°C for 20 min, 95°C for 3 min,1 Cycle; Stage 2: 94°C for 30 sec, 60°C for 30 sec, 72°C for 30 sec, 40 Cycles; Stage 3: 72°C for 50 min. SNHG5's forward primer was 5'- CGCTTGGTTAAAACCTGACACT -3' and its reverse primer was 5'- CCAAGACAATCTGGCCTCTATC -3'. Relative expression level of SNHG5 was calculated using 2-ΔΔCT method after normalization with reference gene (GAPDH).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!