Sheep antidigoxigenin antibody

To confirm that miR‐495 was transfected into the tumours, in situ hybridization and staining were performed. Briefly, frozen tumour sections placed on slides were pre‐treated with 0.2 M HCl, washed in 2 mg/ml glycine‐PBS and acetylated in a 0.1 M triethanolamine (pH 8.0) 0.25% acetic anhydride solution. The slides were heated to 90°C for 5 min., cooled over ice and pre‐hybridized in a solution containing 50% formamide, 0.6 M NaCl, 2 mM Tris‐HCl, pH 7.4, 1 mM EDTA, 1.0 mg/ml BSA, 0.02% PVP, 0.02% Ficoll, 10 mM DTT, 0.2 mg/ml ssDNA and 10% dextran sulphate. The hybridization was performed at 45°C overnight in a mixture containing a pre‐hybridization solution and 300 ng of digoxigenin‐labelled sense or nonsense miR‐495 probes (the sense and nonsense sequences are 5′‐AAGAAGUGCACCAUGUUUGUUU‐3′ and 5′‐GACCUUCAUGUACCUGGCACCG‐3′, respectively, Dako, Santa Barbara, CA, USA) for each sample. After hybridization, the samples were washed in 4 × SSC, and the unbound RNA probe was removed with RNase treatment. The samples were washed at a final stringency of 0.1 × SSC, 1 mM EDTA, and 1 mM DTT at 45°C. The DIG‐labelled miR‐495 probe was detected with a sheep antidigoxigenin antibody (dilution 1:100) coupled to alkaline phosphatase (Roche Diagnostics, Basel, Switzerland), which was used with a colour‐forming substrate solution according to the protocol provided by the manufacturer.

Rabbit retinas were homogenized in 96 μL of extraction buffer (100 mM NaCl, 2 mM CaCl₂, 0.25 mM Tris [pH 8.0]) with 0.05% Tween per milligram tissue weight, using a Precellys tissue homogenizer (Bertin Technologies) and Zirconia beads (Biospec Products). Homogenates were incubated with 0.92 mg/mL Proteinase K (Sigma-Aldrich) for 1 hr at 37°C and centrifuged for 3 min at 3,000 rpm at 4°C. The concentration of QR-110 in the supernatants was determined using two-step hybridization ELISA. First, QR-110 was captured by a fully phosphorothioated biotin-labeled probe (complementary to the 3′ end of QR-110) onto a streptavidin-coated MSD plate (Meso Scale Diagnostics). Next, the plate was washed and incubated with a digoxigenin-labeled detection oligonucleotide probe (complementary to the 5′ end of QR-110). Following washing, the plate was incubated with sheep anti-Digoxigenin antibody (Roche), washed and incubated with Sulpho-Tag donkey anti-sheep antibody (Meso Scale Diagnostics), and analyzed on a Meso Scale Sector S600 (Meso Scale Diagnostics). Calibration curves, generated using four-parameter logistic (4PL) curve fit regression (weighing factor = 1/Y2), were used to calculate the concentration of QR-110 in the test samples.

ESCs were plated on gelatin-coated feeder-free plates. Cells were fixed with 4% paraformaldhehyde (PFA) for 30 min, followed by washing with PBS-T (0.05% tween). Cells were hybridized overnight with 1 µg digoxigenin-labeled riboprobe at 60°C. Cells were blocked with Blocking Solution (Roche) and stained with primary antibodies for 1 h at room temperature. Antibodies used: sheep anti digoxigenin antibody (1∶2,000; Roche), rabbit anti OCT3/4 (1∶500; Abcam) and rabbit anti NANOG (1∶500; Abcam). After washing three times for 5 min with PBS-T, cells were stained with secondary antibodies (1∶200 anti sheep and rabbit IgG Alexa fluor 488 and 594) for 30 min at room temperature and washed again three times with PBS-T. Cells were stained with DAPI in PBS for 2 min and then imaged using a fluorescence microscope and oil objective.