The expressions of GATA3 and CHI3L1 genes mRNA were analyzed using quantitative real-time polymerase chain reaction (qRT-PCR). Briefly, the HUVECs’ total RNA was extracted using E.Z.N.A. Total RNA Kit (OMEGA Bio-Tek, USA), respectively, and the aforementioned samples total RNA was reversely transcribed into cDNA using the RNA reverse transcription kit (TOYOBO, Japan). RT-PCR was then carried out by KOD SYBR qPCR Mix kit (TOYOBO, Japan) and targeting primers. The reaction system was utilized for 20 uL, with reaction conditions of 98°C (2 minutes), 40 cycles of 98°C (10 seconds), 60°C (10 seconds) and 68°C (30 seconds). The melting curve was then analyzed. Experimental apparatus used LightCycler 480 II real-time fluorescent qPCR. The qRT-PCR data were quantified using 2−ΔΔCt. All gene primer sequences are shown as follows:
Kod sybr qpcr mix kit
Manufactured by Toyobo
Sourced in Japan
The KOD SYBR qPCR Mix kit is a reagent used for quantitative real-time PCR (qPCR) amplification and detection of DNA sequences. It contains the KOD DNA polymerase, SYBR Green I dye, and necessary buffers and reagents for performing qPCR reactions.
Automatically generated - may contain errors
Lab products found in correlation
Revertra ace qpcr rt master mix with gdna remover kit, by Toyobo (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Cytoplasmic nuclear rna purification kit, by Norgen Biotek (2 mentions)
Revertra ace qpcr rt master mix with gdna remover, by Toyobo (2 mentions)
Qtower 3 g touch thermal cycler, by Analytik Jena (2 mentions)
E z n a total rna kit, by Omega Bio-Tek (1 mentions)
Rna reverse transcription kit, by Toyobo (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit, by Toyobo (1 mentions)
Lightcycler 480 instrument 2, by Roche (1 mentions)
Revertra ace qpcr rt master mix, by Toyobo (1 mentions)
Gdna remover kit, by Toyobo (1 mentions)
Trizol, by Takara Bio (1 mentions)
Lightcycler 480 2 real time pcr system, by Roche (1 mentions)
First strand cdna synthesis kit, by Toyobo (1 mentions)
Revertra ace qpcr rt master mix kit, by Toyobo (1 mentions)
Lightcycler 96 system, by Roche (1 mentions)
Isogen reagent, by Nippon Gene (1 mentions)
Iq5 optical system, by Bio-Rad (1 mentions)
Applied biosystems proflex pcr system, by Thermo Fisher Scientific (1 mentions)
11 protocols using kod sybr qpcr mix kit
1
Quantitative Analysis of GATA3 and CHI3L1 Gene Expression
2
Quantitative Real-Time PCR Protocol for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA were extracted from tissues and cell lines using Trizol (Thermo Fisher Scientific, Waltham, MA, USA) following the manufacturer’s protocol. cDNA was synthesized using the PrimeScript RT reagent Kit (TOYOBO, Osaka, Japan) following the manufacturer’s protocol. For qRT-PCR, the NELFCD primer sequences were sense, 5′-ATGCTGAACTTCACCGTTAAGC-3′ and antisense, 5′-TGGGCAAACAGGTACGTGTG-3′. To normalize for RNA concentration, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control. The sequences of the GAPDH primers were sense, 5′-ACCTGACCTGCCGTCTAGAA-3′ and antisense, 5′-TCCACCACCCTGTTGCTGTA-3′. The 2−ΔΔCT method was used to calculate the relative amount of NELFCD compared with GAPDH expression. qRT-PCR was performed using the KOD SYBR qPCR Mix kit (TOYOBO). The amplification protocol included an initial denaturation step at 98°C for 2 minutes, followed by 40 cycles of 98°C for 10 seconds, 60°C for 10 seconds and 68°C for 30 seconds. qRT-PCR was performed in a Light Cycler 480 II instrument (Hoffman-La Roche Ltd., Basel, Switzerland).
3
Quantitative RT-PCR analysis of gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
First-strand cDNAs were synthesized using a ReverTra Ace qPCR RT Master Mix with a gDNA Remover kit (Toyobo, FSQ-301; Osaka, Japan). qRT-PCR was performed using a KOD SYBR qPCR Mix kit (Toyobo, QKD-201; Osaka, Japan) with an Exicycler 96 Real-Time Quantitative Thermal Block System (Bioneer, Daejeon, Republic of Korea). The expression levels were calculated from two technical replicates of two biological replicates (n = 4) using the 2−ΔCT method [46 (link)]. The rice Actin1 gene was used as an internal control for normalization. The representative DEGs were selected based on the following criteria: being among the top 100 significant p-values, having an expression level of more than 10 RPKM in the highest expression condition, and having a functional annotation. Primers used in this study are listed in Table S10 .
4
STAR Gene Expression Analysis in Cos7 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 1 μg each of pcDNA3.1, WT, S186R, Q258*, Q258*/S186R-STAR plasmids, and lip3000 were transfected into Cos7 cells at a ratio of 1:2. After 48 h of transfection, the total RNA of the transfected Cos7 cells was extracted using TRIzol (Takara, Japan), quantified using a NanoDrop spectrophotometer (United States), and reverse-transcribed using the First Strand cDNA Synthesis kit (Toyobo, Japan) and oligo-dT primers on a Roche LightCycler 480 II Real-Time PCR System (Roche, United States). Relative gene expression was determined by the comparative method (2−ΔΔCT) using a KOD SYBR qPCR Mix Kit (Toyobo, Japan) and gene-specific primers: Star forward, AGACTTCGGGAACATGCCTGAG-3; reverse, GACCTGGTTGATGATGCTCTTGG; GAPDH forward, GCCTTCCGTGTTCCTACC; reverse, GCCTGCTTCACCACCTTC.
5
Quantifying Pancreatic Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from isolated pancreatic tissues using ISOGEN reagent (Nippon Gene Co., Ltd.) and cDNA was synthesized using a ReverTra Ace qPCR RT Master Mix kit (Toyobo Life Science) in accordance with the manufacturer's protocol. The RT-qPCR analysis was performed with a KOD SYBR qPCR Mix kit (Toyobo Life Science) following the manufacturer's protocol. PCR amplification was performed on PCR machine LightCycler 96 System (Roche Diagnostics GmbH). qPCR was performed using the following thermocycling conditions: Initial denaturation at 98°C for 120 sec; then 40 cycles were performed at 98°C for 10 sec, 68°C for 10 sec and 60°C for 30 sec; finally, the dissolution process was carried out at 95°C, 65°C and 97°C for 10, 60 and 1 sec, respectively. Expression levels of mRNA were analyzed using the comparative threshold cycle method (28 (link)) and normalized to β-actin or glyceraldehyde 3-phosphate dehydrogenase. The primers used in the RT-qPCR are shown in Table I .
6
Quantitative PCR Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was reverse transcribed into cDNA after residual genomic DNA degradation by ReverTra Ace® qPCR RTMaster Mix with gDNA remover Kit (TOYOBO, Japan). Then quantitative PCR experiments were performed on Bio-Rad iQ5 Optical System (BIO-RAD Laboratories, Inc., United States) with KOD SYBR® qPCR Mix Kit (TOYOBO, Japan). Primers used in this process were designed in Primer Premier 6 (United States), and the primer sequences are given in Supplementary Table S2 . The relative expression levels were calculated according to the absolute quantification of mRNA based on standard curve line as commonly recommended (Bustin, 2000 (link)). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene was used as an internal standard (Meng et al., 2016 (link); Meng and Fricke, 2017 (link)). As designed, each group included three biological replicates and each cDNA sample was carried out with three independent technical repetitions.
7
Quantification of IER3 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The BMMC was treated by TRIzol™ Reagent (Thermo Fisher Scientific) to extract total RNA, which was then submitted to perform reverse transcription using ReverTra Ace® qPCR RT Kit (Toyobo). Thereafter, qPCR was carried out on Applied Biosystems™ ProFlex™ PCR System (Thermo Fisher Scientific) with KOD SYBR® qPCR Mix kit (Toyobo). GAPDH was served as reference gene. The relative quantitative analysis of IER3 expression was conducted with the use of 2‐ΔΔCt method.11 The primer sequences for IER3 were: forward: 5′‐TCCTGTTTTGTCTCCCCTTACG‐3′ and reverse: 5′‐TCAGGATCTGGCAGAAGACGAT‐3′.12 The primers sequences for GAPDH were: forward: 5′‐TGACCACAGTCCATGCCATCAC‐3′, and reverse: 5′‐GCCTGCTTCACCACCTTCTTGA‐3′.
8
Comprehensive RNA and DNA Extraction Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted from tissue and cell samples using TRIzol® Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. Nuclear and cytoplasmic RNA were isolated from cells using a Cytoplasmic & Nuclear RNA Purification Kit (Norgen Biotek, Thorold, ON, Canada; Product # 21000, 37400). The concentration and purity of all RNA samples were subsequently measured using a NanoDrop 2000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA). The corresponding cDNAs were generated using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, Osaka, Japan). gDNA was extracted from cells using a Genomic DNA Kit (Omega Bio-Tek, Guangzhou, China) following the manufacturer's instructions. qRT‒PCR was performed on a LightCycler 480 Real-Time PCR System (Roche, Basel, Switzerland) using a KOD SYBR® qPCR Mix Kit (TOYOBO, Osaka, Japan) according to the manufacturer's protocol. The relative quantification of circRNA and messenger RNA (mRNA) expression was carried out by the 2-ΔΔCt method, and GAPDH was used as an internal control. All primer pairs were designed and synthesized by Tsingke Biotechnology Co., Ltd. (Beijing, China), and the sequences of the forward and reverse primers are listed in Supplemental Table 1
9
Quantitative Profiling of circRNAs and mRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol® Reagent (Invitrogen, Waltham, MA, USA) according to the manufacturer’s instructions. Nuclear and cytoplasmic RNA were isolated from AML cells using a Cytoplasmic & Nuclear RNA Purification Kit (Norgen Biotek, Thorold, ON, Canada). Reverse transcription was performed using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, Osaka, Japan), and qRT–PCR was performed using a KOD SYBR® qPCR Mix Kit (TOYOBO, Japan) according to the manufacturer’s protocol. The relative expressions of circRNAs and mRNAs were calculated using the 2−ΔCt method (ΔCt = CtcircZBTB46 − CtGAPDH), whereas the fold change (FC) was calculated using the 2−ΔΔCt method (ΔΔCt = ΔCttest − ΔCtcontrol), and GAPDH was utilized as an internal control. All primer pairs were designed and synthesized by Tsingke Biotechnology Co., Ltd. (Beijing, China), and the sequences of the primers are listed in Table 1 .
10
Maize Transcriptome Profiling and Validation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sequencing data was ltered with SOAPmuke and clean reads were obtained. The clean reads were mapped to the maize reference genome (https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/902/167/145/GCF_902167145.1_Zm-B73-REFERENCE-NAM-5.0/GCF_902167145.1_Zm-B73-REFERENCE-NAM-5.0_genomic.fna.gz) using HISAT2. Bowtie2 was applied to align the clean reads to the reference coding gene set, then gene expression was calculated by RSEM. The heatmap was drawn by MeV (v4.9.0) according to the gene expression. Differential expression analysis was performed using DESeq2 with Q value ≤ 0.05. Gene ontology enrichment was performed by g:Pro ler (http://biit.cs.ut.ee/gpro ler/gost) based on Hypergeometric test. The signi cant terms were corrected by Q value with a threshold (Q value ≤ 0.05) by Bonferroni.
Validation of RNA-seq by qRT-PCR Ten DEGs were randomly selected and expression levels were validated by qRT-PCR. Primers were designed in qPrimerDB (https://biodb.swu.edu.cn/qprimerdb/) (Table S10). cDNA was synthesized with a ReverTra Ace qPCR RT Master Mix with gDNA Remover Kit (Toyobo Life Science, Japan). qRT-PCR was performed with a KOD SYBR qPCR Mix Kit (Toyobo Life Science, Japan) on a qTOWER3G Touch thermal cycler (Analytikjena, Germany). ZmActin was used as internal control to normalize the results. The relative expression was calculated using the 2 -ΔΔCt method.
Validation of RNA-seq by qRT-PCR Ten DEGs were randomly selected and expression levels were validated by qRT-PCR. Primers were designed in qPrimerDB (https://biodb.swu.edu.cn/qprimerdb/) (Table S10). cDNA was synthesized with a ReverTra Ace qPCR RT Master Mix with gDNA Remover Kit (Toyobo Life Science, Japan). qRT-PCR was performed with a KOD SYBR qPCR Mix Kit (Toyobo Life Science, Japan) on a qTOWER3G Touch thermal cycler (Analytikjena, Germany). ZmActin was used as internal control to normalize the results. The relative expression was calculated using the 2 -ΔΔCt method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!