Rna dna extracol kit

After qualifying for participation in the study (in the years 2021–2022) and giving written consent to participate in the study, whole blood was collected from each participant from the cubital vein into a properly coded tube and stored at -20°C until the isolation of the genetic material. Genomic DNA and total RNA were isolated with a commercial kit—DNA/RNA Extracol Kit (EURX, Gdansk, Poland) as previously described by Grębowski et al. (2023) [27 (link)].

Total DNA was isolated from trigeminal ganglia and brains preserved in RNA fix (Eurx) using RNA/DNA Extracol kit (Eurx), according to the manufacturer’s instructions. HSV-1 was detected using an HSV-1 probe labeled with FAM (carboxyfluorescein) in quantitative polymerase chain reaction (qPCR) instrument ViiA 7 (Fast block; Applied Biosystems) with Fast Advanced Master Mix (Thermo Fisher Scientific) as described by Namvar et al [19 (link)] and Cymerys et al [20 (link)].

Total RNA was isolated from tissue homogenates using the RNA/DNA Extracol kit (Eurx), as above. ICP0, ICP27, gB, and latency-associated transcript (LAT) were measured as described by Menendez et al [21 (link)] using GoTaq SYBR PCR System (Promega). HSV-1 LAT and lytic genes were normalized to the mean cycle threshold of β-actin. Expression of IFN-α 2, IFN-α 4, IFN-γ, IL-1β, TNF-α, IL-6, CXCL1/2, CXCL9, CXCL10, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was quantified using Taqman Gene Expression Assays and Fast Advanced Master Mix (ThermoFisher). All PCRs were carried out in qPCR instrument ViiA 7 (Fast block; Applied Biosystems).

Total DNA and RNA from vaginal tissues and spinal cords were isolated at day 7 post HSV-2 infection using RNA/DNA Extracol kit (Eurx, Gdansk, Poland). DNA from infected cell cultures was isolated with Universal RNA/DNA extraction kit (Eurx). HSV-2 was detected by qPCR with primers and probe for the viral envelope glycoprotein (gB), as described by Namvar et al. [16 (link)] in Rotor-Gene Q (Qiagen, Hilden, Germany) with GoTaq^® Probe qPCR Master Mix (Promega, Madison, WI, USA). Forward primer: ‘TGCAGTTTACGTATAACCACATACAGC’, reverse primer: ‘AGCTTGCGGGCCTCGTT’ and probe: 5′ FAM-CGCCCCAGCATGTCGTTCACGT’. Standard curve analysis was based on Ct values and serial of 10-fold dilutions of the plasmid standard containing the gB gene with an initial concentration of 2.62 × 10⁶ HSV-2 genome copy numbers per reaction. A standard curve was included in each PCR run. Data are expressed as the HSV-2 copy number per ng of the total DNA in the tissue.

The total DNA was isolated from the spinal cords and vaginal tissues preserved in RNAlater (Thermo Fisher Scientific, Waltham, MA, USA) using an RNA/DNA Extracol kit (Eurx, Gdansk, Poland). HSV-2 was detected using a HSV-2 probe labeled with FAM in a real-time PCR instrument, the Stratagene MX4000 Real-Time qPCR System (Agilent Technologies, Santa Clara, CA, USA), as described by Namvar et al. in 2005 [24 (link)]. A plasmid vector, pCR 2.1, containing envelope glycoprotein (gB) gene fragment was constructed and purified by the Institute of Biochemistry and Biophysics, Polish Academy of Sciences (Warsaw, Poland). The standard curve analysis was based on Ct values and the serial of 10-fold dilutions of the plasmid standard with an initial concentration of 2.62 × 10⁶ HSV-2 genome copy numbers per reaction. A standard curve was included in each PCR run. The amplification efficiency (E) was calculated from the standard curves, using the formula E = 10(−1/a) − 1, where a is the slope. Data are expressed as the HSV-2 copy number per ng of the total DNA in the tissue.

Total DNA was isolated from trigeminal ganglia and brains preserved in RNA later (Thermo Fisher Scientific, MA, USA) using RNA/DNA Extracol kit (EURx, Gdansk, Poland). HSV-1 was detected using a HSV-1 probe labeled with FAM in a real-time PCR instrument Stratagene MX4000 Real-Time qPCR System (Agilent Technologies, USA) as described by Namvar et al. [27 (link)] and Orłowski et al. [28 (link)]. A plasmid vector pCR 2.1 containing an envelope glycoprotein (gB) gene fragment was constructed and purified by the Institute of Biochemistry and Biophysics Polish Academy of Sciences (Warsaw, Poland). Standard curve analysis was based on Ct values and serial of 10-fold dilutions of the plasmid standard with an initial concentration of 2.62 × 10⁶ HSV-1 genome copy numbers per reaction. A standard curve was included in each PCR run. The amplification efficiency (E) was calculated from the standard curves, using the formula E = 10(−1/a) − 1, where a is the slope. Data are expressed as the HSV-1 copy number per ng of the total DNA in the tissue.