Dneasy powerwater dna isolation kit
The DNeasy PowerWater DNA Isolation Kit is a laboratory equipment product designed to isolate and purify DNA from water samples. It provides a reliable and efficient method for extracting high-quality genomic DNA from a variety of water sources.
Lab products found in correlation
9 protocols using dneasy powerwater dna isolation kit
Environmental DNA Extraction and Quantification
Filtration and DNA Extraction from Water Samples
Bacterial and Fungal DNA Extraction
DNA Extraction from Filters using DNeasy Kit
eDNA Extraction and Primer Design for Chinese Sturgeon
Forward primer 5′ GGCAATTTTAATCTGGGTTTCCA 3′;
Reverse primer 5′ TGGATGTTAGATATATGTCCTTG 3′.
Analyzing Shrimp Stomach Contents
DNA Extraction from Anodisc Samples
DNA Extraction from Aquatic and Sediment Samples
Shotgun metagenome sequencing protocol
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!