Dneasy powerwater dna isolation kit

The DNA extraction was conducted on filters using DNeasy PowerWater DNA Isolation Kit (QIAGEN), and isolation was carried out with recommended protocols (QIAGEN). DNA extracts were sent to the Farncombe Metagenomics Facility at McMaster University, (Hamilton, Ontario) for subsequent analysis. Library concentrations were quantified through quantitative PCR (qPCR) and concentrations were adjusted as appropriate at each step of the molecular protocol.

The eDNA was extracted from filtered membranes following the standard protocol of the DNeasy® PowerWater® DNA Isolation Kit (Qiagen). Before DNA extraction, we ripped each filtered membrane into a few pieces within a sterile tube. Extraction negative controls (consisting of the same extraction materials with no filter, replaced with nuclease-free water) were run for each extraction batch (n = 32) to monitor for any contamination. To optimize the detection and identification, we designed a pair of specific diagnostic primers for Chinese sturgeon from the D-loop region on the mitochondrial DNA genome. Primers were designed using Primer-BLAST [49 ] and checked for potential cross-amplifications in syntopic taxa (Additional file 1: Appendix S1). The primers amplifie a fragment of 132 bp in length and sequences of primers are shown as below:

Forward primer 5′ GGCAATTTTAATCTGGGTTTCCA 3′;

Reverse primer 5′ TGGATGTTAGATATATGTCCTTG 3′.

In total, 483 stomachs (Supporting Information Table S1) were dissected using flame‐sterilized tools from shrimp that had a visually full stomach. Single shrimp stomachs likely contain only DNA from a limited number of fish due to their small size and fast gut passage time (Feller, 2006; Pihl & Rosenberg, 1984). Up to eight full stomachs were, therefore, pooled prior to DNA extraction (Deagle et al., 2005; Ray et al., 2016), resulting in three extractions per site. Three sites (Av3, Me4 and Ke2) contained only two samples due to a low number of shrimp caught with full stomachs at these locations (see Siegenthaler et al., 2018). Water samples (0.9 L) were filtered using Sterivex filter units (0.22 µm pore size; Merck Millipore) upon arrival to the laboratory (within 4 hr after collection). Pooled stomach (0.25 g) and sediment (10 g) samples were homogenized and DNA extracted using the PowerSoil^® DNA isolation Kit (Qiagen) and the PowerMax^® DNA Soil Kit (Qiagen), respectively. For the water samples, DNA was extracted from the filters and isolated using the DNeasy PowerWater^® DNA isolation Kit (Qiagen). A Qubit fluorometer (Thermo‐Fisher Scientific) was used to assess the DNA concentrations of the purified extracts. DNA extraction and pre‐PCR preparations were performed in separate laboratories from post‐PCR procedures to avoid contaminations.

DNeasy PowerWater DNA Isolation Kit (Qiagen, Germany) protocol was followed for DNA extraction. Briefly, 1 ml PW1 and 10 μl Proteinase K (20 μl ml⁻¹ final concentration) were added to the bead tube containing the Anodisc and incubated overnight at 55°C. The tube was then vortexed for 3 min, followed by sonication in an ultrasonic bath for 30 min at 65°C in sweep mode before vortexing for another 5 min. The supernatant was then used for DNA extraction, following the manufacturer's protocol. The DNA was eluted from the column using 60 μl of PW6. The eluate was then reloaded onto the spin column for a second time to maximize DNA recovery. Extracted DNA samples were quantitated on a Qubit 2.0 fluorometer, using the Qubit dsDNA HS (High Sensitivity) Assay Kit (Invitrogen, USA).

Water and FFT cells were retrieved by filtering ~1.5 L water through 0.22 μm Rapid-Flow sterile disposable filters (Thermo Fisher Scientific (Waltham, MA, USA)) and from ca. 50 g wet FFT, respectively, and stored at −20 °C until DNA was extracted. DNA was extracted and purified from water column samples using the DNeasy PowerWater DNA Isolation Kit (Qiagen, Hilden, Germany), while ca. 0.5 g of each FFT sample was extracted using the FastDNA Spin Kit for Soil (MP Biomedical, Irvine, CA, USA). DNA concentration and quality were confirmed with a Qubit 2.0 Fluorometer (Thermo Fisher Scientific, Waltham, MA, USA) using a Qubit High-Sensitivity dsDNA Assay Kit (Thermo Fisher Scientific, Waltham, MA, USA), and DNA quality was assessed using an Epoch Microplate Spectrophotometer with Take3 plate (BioTek, Winooski, VT, USA).