Abi 3730 platform
The ABI 3730 platform is a high-performance DNA sequencing system designed for automated, high-throughput DNA sequencing. It features a capillary electrophoresis system with 96 capillaries and is capable of generating up to 1,152 sequencing reactions per day. The ABI 3730 platform is widely used in genomics research and applications that require accurate and reliable DNA sequencing data.
Lab products found in correlation
9 protocols using abi 3730 platform
Amplification and Sequencing of Rotifer and Biomphalaria coxI
Screening ELOVL5 c.689G>T Mutation
Validating Transcriptome Derived SNPs
Molecular Characterization of Clinical Klebsiella pneumoniae Isolates
Amplification and Cloning of Satallite DNA
Detecting and Characterizing Antibiotic Resistance Genes
SMPX Variant Amplification and Sequencing
SMPX (GenBank: NG_031916.1) variant was amplified and sequenced with a pair of SMPX‐specific primers: 5'‐GTTTCAGGGCTGACTGAGCA‐3′ (forward) and 5′‐ATTCCAATGGGAGCCTTTCGG‐3′ (reverse). Sanger sequencing was conducted on ABI3730 platform (Applied Biosystems).
Microsatellite Instability Analysis
Characterization of Carbapenem-Resistant Enterobacter Strain
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!