Electrophoretic mobility shift assay kit

Electrophoretic Mobility Shift Assay was performed using the Electrophoretic Mobility Shift Assay kit (Invitrogen, Carlsbad, CA, USA). The DNA-protein binding reaction was performed by incubating purified HbMADS4 with double-stranded HbSRPP promoter nucleotides at room temperature for 30 min, and then analyzed by polyacrylamide gel electrophoresis. The gel was stained with SYBR Green EMSA stain for visualizing DNA, the same gel was stained with SYPRO Ruby EMSA stain for monitoring protein.

To create the HJ DNA substrate, four complementary oligonucleotides (oligo 1, 5'-GTCGGATCCTCTAGACAGCTCCATGATCACTGGCACTGGTAGAATTCGGC-3'; oligo 2, 5'-CAACGTCATAGACGATT ACATTGCTACATGGAGCTGTC TAGAGGATCCGA-3'; oligo 3, 5'-TGCCGAATTCTACCAGT GCCAGTGATGGACATCTTTGCCACGTTGACCC-3'; oligo 4, 5'-TGGGTCAACGTGGGCAAGATGTCCTAGCAATGTAATCGTCTATGACGT-3') were synthesized as described previously (McGlynn et al., 2000 (link)). The oligonucleotides were denatured for 15 min at 95°C and allowed to anneal at 25°C for 45 min. To examine the DNA binding activity of RecG-WD, an electrophoretic mobility shift assay kit (Invitrogen, Carlsbad, CA, United States) was used. Purified recombinant RecG-WD proteins and 100 nM of HJ DNA substrates were mixed in binding buffer containing 50 mM Tris-HCl (pH 8.0), 5 mM EDTA, 1 mM dithiothreitol, 100 μg/ml bovine serum albumin, and 6% glycerol (v/v) and incubated on ice for 15 min as described previously (McGlynn et al., 1997 (link); Briggs et al., 2005 (link)). The DNA binding reaction was terminated by the addition of 2 μl of 2× loading dye. Samples were loaded onto 6% polyacrylamide gels in low-ionic strength buffer at 120 V for 35 min at room temperature, and the electrophoresed DNA-protein complexes were visualized using a ChemiDoc™ Touch imaging system (Bio-Rad, Hercules, CA, United States). Reaction products were quantified using Image Lab Software (Bio-Rad).

Electrophoretic mobility–shift assay (EMSA) was performed using Electrophoretic Mobility-Shift Assay kit (Invitrogen: E33075), according to the manufacturer's instructions. The following IRE containing mouse Slc40a1 5’ UTR with T7 promoter was synthesized by Integrated DNA Technologies (gBlocks Gene Fragments): 5’-TAATACGACTCACTATAGGGGAGAGCAGGCTCGGGGTCTCCTGCGGCCGGTGGATCCTCCAACCCGCTCCCATAAGGCTTTGGCTTTCCAACTTCAGCTACAGTGTTAGCTAAGTTTGGAAAGAAGACAAAAAGAAGACCCCGTGACAGCTTTGCTGTTGTTGTTTGCCTTAGTTGTCCTTTGGGGTCTTTCGGCATAAGGCTGTTGTGCTTATACTGGTGCTATCTTCGGTTCCTCTCACTCCTGTGAACAAGCTCCCGGGCAAGAGCAGCTAAAGCTACCAGCAT-3’. The 287 bp fragment was cloned into pCR-Blunt II-TOPO (Invitrogen: 451245). This plasmid DNA containing the mouse Slc40a1 5’ UTR was linearized by EcoRI and transcribed using HiScrib T7 Quick High Yield RNA Synthesis Kit (New England Biolabs: E2050S). Twenty micrograms of total protein homogenates from mouse heart were incubated with 50 ng of RNA oligonucleotides and subjected to electrophoresis on 6% nondenaturing polyacrylamide gels. The gels were stained using SYBR Green EMSA stain and captured using ChemiDoc-It Imaging Systems with Transilluminator (UVP).

The EMSA was performed with the Electrophoretic Mobility Shift Assay kit (Invitrogen, USA) following the manufacturer’s instruction. The CDS of HbMYC18 was cloned into the prokaryotic expression vector pET-28a, and then transformed into Escherichia coli strain BL21 (DE3) after sequencing verification. The recombinant HbMYC18-His protein was expressed and affinity-purified using Ni⁺ affinity resin (GE, USA). The 1.2-kb promoter region of HbPSK5 was amplified from the CATAS8-79 genome. The binding reaction was performed by incubating double-stranded DNA of the HbPSK5 promoter with different concentrations of purified recombinant HbMYC18-His protein at room temperature for 30 min in a total volume of 15 μL. The reaction system contained 20 mM Tris-HCl (pH 7.6), 30 mM KCl, 0.2% (w/v) Tween-20, 1 mM DTT, and 10 mM (NH₄)₂SO₄. The DNA-protein complexes were separated on 5% polyacrylamide gels and captured on an Azure Biosystems c300 imaging system (Azure, USA).

The binding of PfsR to the promoter regions of a number of genes was determined by EMSA. DNA fragments for EMSA were amplified by PCR from Synechocystis 6803 genomic DNA. The primers used are listed in Table S1. Each reaction (20 µl) contained 0.05 µM DNA fragments, 0 to 4 µM of purified PfsR protein, and binding buffer [4 mM Tris-HCl (pH 7.5), 12 mM HEPES (pH 7.5), 50 mM NaCl, 10 mM MgCl₂, 12% glycerol]. The reactions were incubated at 25°C for 30 minutes and then subjected to 6% native polyacrylamide gel electrophoresis at 200 V in 0.5×Tris-borate-EDTA (TBE) buffer. The binding of PfsR to promoter regions was detected using the Electrophoretic Mobility Shift Assay (EMSA) Kit (Invitrogen, Carlsbad, CA), according to the manufacturer’s instructions.

The plasmids pET32a-SmMYB36 and pET32a were transformed and expressed in E. coli BL21. HIS-labelled protein was purified out using Ni-NTA Resin (Solarbio, Beijing, China). The elution buffer (pH 8.0) contains 50 mM NaH₂PO₄·2H₂O, 300 mM NaCl and 250 mM imidazole. The promoter fragments were predicted based on the genome sequence of S. miltiorrhiza (http://www.ndctcm.org/shujukujieshao/2015-04-23/27.html) and PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) databases. The MBS, MRE, MBSI and MBSII specific or core element sequences of promoter fragments were used as probes and the sequences of the same length as the above probes of the SmMYB36 open reading frame were used as control probes. (Supplementary Table S1). The EMSA assay was conducted according to the instructions of the Electrophoretic Mobility Shift Assay (EMSA) Kit (Invitrogen). The mass ratio of probe and protein was 1:15 in each reaction mixture (10 µL).

EMSA was carried out by using the Electrophoretic Mobility Shift Assay (EMSA) kit (Invitrogen, Carlsbad, NJ) according to the manufacturer’s instruction. 150-bp DNA fragments containing the wild-type or mutated IR1 sites were used in the assay. The DNA fragments were generated by PCR using the primer set, EMSA_150_F (5′-TCTGGTCGCGCCCTCTTAC-3′) and EMSA_150_R (5′-GGCAGACCGCATCCGCGG-3′) and pBSahpC, pBSM1, and pBSM2 as templates to obtain the corresponding DNA fragments. Reaction mixtures for DNA-protein binding were composed of appropriate amounts of DNA (2 µl), purified Crp (5 µl), distilled H₂O (1 µ), and 5× binding buffer included in the kit (2 µl). cAMP was added to a final concentration of 100 µM. The binding reaction mixtures were incubated for 20 min at room temperature. After the addition of 2 µl of 6× loading buffer (included in the kit), the mixtures were subject to nondenaturing PAGE [8% (wt/vol) acrylamide] in 0.5× TBE buffer (41.5 mM Tris-borate and 0.5 mM EDTA, pH 8.3) at 14 V/cm for 2 h 20 min at 4°C. The gels were stained with the SYBR green staining solution (Invitrogen).