DNA was isolated from cells using DNA QuickExtract (Epicentre, Madison, WI) following treatment by 0.05% trypsin-EDTA and centrifugation. QuickExtract solution was incubated at 65 ºC for 15 min, 68 ºC for 15 min, and then 98 ºC for 10 min. Genomic PCR was performed following manufacturer’s instructions using Q5 High fidelity DNA polymerase (New England Biolabs) and ~500 ng of genomic DNA. Products were then purified using AMPure XP magnetic bead purification kit (Beckman Coulter) and quantified using a Nanodrop2000 or Qubit (Thermo Fisher). For deep sequencing of the APP locus, genomic DNA was amplified using the following primers: TGTCATAGCGACAGTGATCGT and AGCTAAGCCTAATTCTCTCATAGTC. Samples were pooled and run on an Illumina Miniseq with read length of 150bp. Deep sequencing data was analyzed using the Cas-Analyzer software32 (link).
Ampure xp magnetic bead purification kit
Manufactured by Beckman Coulter
The AMPure XP magnetic bead purification kit is a laboratory reagent used for the selective purification of DNA or RNA samples from various biological samples. The kit utilizes paramagnetic beads coated with a hydrophilic polymer to selectively bind nucleic acids, allowing for the removal of contaminants and impurities through a series of wash steps. The purified samples can then be eluted for downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
4 protocols using ampure xp magnetic bead purification kit
1
DNA Isolation and Deep Sequencing of APP Locus
2
DNA Isolation and Deep Sequencing of APP Locus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was isolated from cells using DNA QuickExtract (Epicentre, Madison, WI) following treatment by 0.05% trypsin-EDTA and centrifugation. QuickExtract solution was incubated at 65 ºC for 15 min, 68 ºC for 15 min, and then 98 ºC for 10 min. Genomic PCR was performed following manufacturer’s instructions using Q5 High fidelity DNA polymerase (New England Biolabs) and ~500 ng of genomic DNA. Products were then purified using AMPure XP magnetic bead purification kit (Beckman Coulter) and quantified using a Nanodrop2000 or Qubit (Thermo Fisher). For deep sequencing of the APP locus, genomic DNA was amplified using the following primers: TGTCATAGCGACAGTGATCGT and AGCTAAGCCTAATTCTCTCATAGTC. Samples were pooled and run on an Illumina Miniseq with read length of 150bp. Deep sequencing data was analyzed using the Cas-Analyzer software32 (link).
3
Genomic DNA Extraction and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was isolated from cells using DNA QuickExtract (Epicentre, Madison, WI) following treatment by 0.05% trypsin-EDTA and centrifugation. The DNA extract solution was incubated at 65 °C for 15 min, 68 °C for 15 min, and finally 98 °C for 10 min. Genomic PCR was performed following manufacturer’s instructions using AccuPrime HiFi Taq (Life Technologies) and 500 ng of genomic DNA. Products were then purified using AMPure XP magnetic bead purification kit (Beckman Coulter) and quantified using a Nanodrop2000. Primer sequences are listed in Supplementary Tables 3 , 6 , and 7 . Genomic target sequences of predicted off-target sites are listed in Supplementary Table 5 . For deep sequencing, samples were pooled and run on an Illumina HiSeq2500 high throughput at a run length of 2 × 125 bp or an Illumina Miseq 2 × 150 bp.
4
Quantitative Genomic PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic PCR was performed using AccuPrime HiFi Taq (Life Technologies) following manufacturer’s instructions. About 200–500 ng of genomic DNA was used for each PCR reaction. Products were then purified using AMPure XP magnetic bead purification kit (Beckman Coulter) and quantified using a Nanodrop2000. Individual samples were pooled and run on an Illumina HiSeq2500 High Throughput at a run length of 2 × 125 bp. A custom python script was developed to perform sequence analysis. For each sample, sequences with frequency of less than 100 reads were filtered from the data. Sequences in which the reads matched with primer and reverse complement subsequences classified as target sequences. These sequences were then aligned with corresponding wildtype sequence using global pairwise sequence alignment. Sequences that were misaligned through gaps or insertions around the expected cut site were classified as NHEJ events. The frequency, length, and position of matches, insertions, deletions, and mismatches were all tracked in the resulting aligned sequences.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!