The labeling of 36-mer oligonucleotide 1(5′ATGAAATCTAACAATGCGCTCATCGT CATCCTCGGC3′) containing high-affinity topoisomerase II binding site was done using polynucleotide kinase (Roche Biochemicals). The labeled oligonucleotide 1 was annealed to oligonucleotide 2 (3′TACTTTAGATTGTTACGCGAGTAGCAGTAGGACCG5′) in a buffer containing 40 mmol/L Tris–HCl (pH 7.5), 20 mmol/L MgCl2, and 50 mmol/L NaCl at 70°C for 1 h and allowed to cool down slowly to room temperature. Briefly, the reaction was done in a 20 μL binding buffer containing 50 mmol/L Tris– HCl (pH 7.5), 1 mmol/L DTT, 4 mmol/L MgCl2, 50 mmol/L KCl, and 15 μg mL−1 BSA and 5 pmol of 36 bp duplex oligonucleotide and LdTOPII enzyme and varying concentrations of JVPH3 and JVPH4. Reaction mixtures were incubated at 4°C for 30 min and electrophoresed through 7% nondenaturing polyacrylamide gel and autoradiographed (Sengupta et al. 2005b (link)).
Polynucleotide kinase
Manufactured by Roche
Sourced in Switzerland
Polynucleotide kinase is a DNA-modifying enzyme that catalyzes the transfer of a phosphate group from ATP to the 5' hydroxyl terminus of DNA or RNA. This enzymatic activity is essential for various molecular biology techniques, such as DNA labeling, end-modification, and ligation.
Automatically generated - may contain errors
Lab products found in correlation
4 protocols using polynucleotide kinase
1
Labeling and Binding of Topoisomerase II
2
Promoter Analysis of eexD Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A 1001-pb fragment corresponding to the promoter region of eexD was amplified by PCR using primers UpeexDrr and DweexDrr. The product was cloned into pJET1.2/blunt resulting in pMCeexD. Total RNA was isolated from AEIV and AErpoS cultures grown for 30 h in BS. Primer extension experiments were carried out at 42°C using avian myeloblastosis virus reverse transcriptase (Roche) with the primer eexDP1 and the cDNAs were end-labeled with (γ-32P)-dATP using polynucleotide kinase (Roche). The sequencing ladders were generated with the same primers using a Thermo Sequenase Cycle Sequencing kit (USB) and plasmid pMCeexD as template.
3
Gel Shift Assay of PcVelA Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gel shift assays were performed using oligonucleotides derived from ChIP-enriched regions and purified GST-PcVelA1–256. Fifty-nucleotide double-stranded oligonucleotides (Table S3 were 5′-end labeled using polynucleotide kinase (Roche, Basel, Switzerland) and [γ-32P]ATP (Hartmann Analytic, Braunschweig, Germany). For shift experiments, 3.5- to 7.0-fmol (~50 to 100 cps) samples of radiolabeled oligonucleotides were incubated with various protein concentrations in the presence of 2 µl binding buffer (250 mM Tris-HCl, pH 8.0, 1 M KCl, 50% glycerol) and 1 µg poly(dI-dC)- poly(dI-dC) (Affymetrix USB, CA, USA) in a total volume of 20 µl for 20 min at room temperature. Samples were run on 5% polyacrylamide gels at 4°C in 190 mM glycine, 27 mM Tris-HCl, pH 8.5.
4
Quantifying Total mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine RNA amount, cells were grown in rich media until the exponential phase total RNA was extracted by phenol:chloroform extraction as described in (31 ) in three biological triplicates and was quantified by OD260 estimation in a Nanodrop device (Thermo-Fisher). Serial dilutions of total RNA were then spotted on a nylon membrane (Nytran SPC, GE Healthcare) and hybridized with a specific oligo d(T)40 probe, terminally labeled with Polynucleotide Kinase (Roche) and γ-32P-ATP. Membranes were exposed to an Imaging plate (BAS-MP, Fujifilm) and scanned by a Fujifilm FLA3000 Phosphorimager. The signal intensity of the spots was quantified with the Array Vision software. These data were used for poly(A) cell concentration calculations, as described in (32 ). Alternatively, the poly(A) quantification in individual cells was done essentially as described (doi.org/10.1101/044735), but an oligo d(T)30V labeled with Cy3 was used. These samples were analyzed in an LSR Fortessa cytometer (Becton Dikinson). Poly(A) amount was taken as estimator of total mRNA and then divided by cell volume to obtain total mRNA concentration ([mRNA]).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!