First strand cDNA synthesis was performed with 1 μg of total RNA isolated from C2C12 cells at 55°C for 20 min. using the Thermoscript II one-step RT-PCR Kit (Life Technologies, Paisley, UK). cDNA amplification was performed in the same tube using the Gene Amp System 9700 thermocycler (Applied Biosystems, Warrington, UK) followed by heating to 94°C for 5 min. to inactivate the reverse transcriptase. The following PCR conditions were used: 34 cycles each of 30 sec. at 94°C, 30 sec. at 55°C and 60 sec. at 72°C, followed by 10 min. at 72°C. The number of PCR cycles used was optimized to ensure amplification at the exponential phase. Ten-microlitre samples from each RT-PCR reaction were removed and analysed by agarose gel electrophoresis. Bands were stained with ethidium bromide and visualized under ultraviolet (UV) light. The band intensities were quantified using a gel documentation system (Gene Genius, Syngene, UK). The following primers were used: GLUT4-sense (5′-TTG GAG AGA GAG CGT CCA AT-3′) and GLUT4-antisense (5′-CTC AAA GAA GGC CAC AAA GC-3′); β-actin-sense (5′-CAG GAG GAG CAA TGA TCT TGA-3′) and β-actin antisense (5′-ACT ACC TCA TGA AGA TCC TCA-3′). RT-PCR experiment with animal tissues was also performed. Various primers were used as indicated.
Thermoscript 2 one step rt pcr kit
Manufactured by Thermo Fisher Scientific
Sourced in United Kingdom
The Thermoscript II one-step RT-PCR Kit is a reagent system used for reverse transcription and polymerase chain reaction (RT-PCR) in a single reaction. It enables the conversion of RNA to complementary DNA (cDNA) and subsequent amplification of the cDNA.
Automatically generated - may contain errors
5 protocols using thermoscript 2 one step rt pcr kit
1
First-Strand cDNA Synthesis and RT-PCR Analysis
2
RT-PCR Analysis of GLUT4 and β-Actin Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
First-strand cDNA was synthesized using 1 μg of total RNA from C2C12 cells at 55 °C for 20 min by using Thermoscript II One-Step RT-PCR Kit (Life Technologies). The cDNA was amplified using GeneAmp PCR System 9700 (Applied Biosystems), followed by heating to 94 °C for 5 min to inactivate the reverse transcriptase. PCR was performed using 34 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, and amplification at 72 °C for 60 s, followed by final elongation at 72 °C for 10 min. The number of PCR cycles was optimized to ensure that the amplification was performed in an exponential phase. Next, 10 μl of the PCR products were analyzed by performing agarose gel electrophoresis. The bands obtained were stained with ethidium bromide and were visualized under u.v. light. Band intensities were quantified using UVP BioDoc-It imaging system (Upland, CA, USA). The PCR was performed using the following primers: GLUT4 sense (5′-TTG GAG AGA GAG CGT CCA AT-3′) and GLUT4 antisense (5′-CTC AAA GAA GGC CAC AAA GC-3′) and β-actin sense (5′-CAG GAG GAG CAA TGA TCT TGA-3′) and β-actin antisense (5′-ACT ACC TCA TGA AGA TCC TCA-3′). Each experiment was repeated three times.
3
RT-PCR Amplification of Glucose, Insulin Receptor
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-PCR was performed at 55°C for 20 minutes using the Thermoscript II one-step RT-PCR Kit (Invitrogen). cDNA amplification was performed using a GeneAmpSystem 9700 thermocycler (Applied Biosystems, Warrington, UK). The reverse transcriptase was heat-inactivated in the first step of the PCR reaction (94°C for 5 minutes). The following primers were used for amplification: β-actin, 5′-ATTTGGTCGTATTGGGCGCCTGGTCACC-3′ (sense) and 5′-GAAGATGGTGATGGGATTTC- 3′ (antisense); GLUT3, 5′-CGCAACTCTATGCTTCTAGTCAA- 3′ (sense) and 5′ -ATGCCCAGCTGGTTTAGTGT- 3′ (antisense); and an insulin receptor, 5′-gtactgggagaggcaagcag- 3′ (sense) and 5′-gtgtggtggctgtcacattc- 3′ (antisense). The amplification steps were as follows: 27 cycles at 94°C for 30 seconds, 56°C for 30 seconds, and 72°C for 30 seconds, followed by 7 minutes at 72°C. Ten microliters of product from each RT-PCR reaction were analyzed through agarose gel electrophoresis.
4
Quantitative Analysis of Metabolic Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reverse transcription polymerase chain reaction (RT‐PCR) was performed at 55 °C for 20 min using a Thermoscript II one‐step RT‐PCR Kit (Invitrogen). cDNA amplification was carried out using a Gene Amp System 9700 thermocycler (Applied Biosystems, Warrington, UK). The reverse transcriptase was heat‐inactivated in the first step of the PCR (95 °C for 10 min). The following primers were used for amplification: metrnl, sense 5′‐AAGCCTTTCAGGGACTCCTC‐3′ and antisense 5′‐CCCTGGTCGTACTCCACACT‐3′; β‐actin, sense 5′‐ATTTGGTCGTATTGGGCGCCTGGTCACC‐3′ and antisense 5′‐GAAGATGGTGATGGGATTTC‐3′; GLUT4 for real‐time PCR, sense 5′‐AGCTGGTGTGGTCAATACGG‐3′ and antisense 5′‐AACAGATGGAGTGTCCGTCG‐3′; GLUT4 for ChIP, sense 5′‐CTTCGACCTTTCAGGGGGAC‐3′ and antisense 5′‐GAACAAAAGGCTCTTCCCGC‐3′. The amplification steps were as follows: 32 cycles of 95 °C for 15 s, 58 °C (β‐actin) or 55 °C (GLUT4 and metrnl) for 30 s, and 72 °C for 30 s, followed by 10 min at 72 °C. After each reaction, 10 µL was analyzed by agarose gel electrophoresis. For real‐time PCR, the relative amount of the target genes was determined by measuring the cycle threshold values of the target genes and β‐actin. The relative amount of the target genes was normalized against β‐actin, the internal control in the same sample, and described as the ratio of each target gene/β‐actin.
5
Quantification of GLUT4 Expression in C2C12 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One microgram of total RNA was extracted from C2C12 cells. The reaction was performed at 55 8C for 20 min using the ThermoScript II One-Step RT-PCR Kit (Invitrogen). cDNA was amplified using the Gene Amp System 9700 thermocycler (Applied Biosystems). The reverse transcriptase was heat-inactivated in the first step of the PCR (94 8C for 5 min). The following primers were used for amplification: GLUT4 forward: 5 0 -CAGCCTACGCCACCATAG-TAC-3 0 and reverse: 5 0 -TTCCAGCAGCAGCAGAG-3 0 ; b-actin forward: 5 0 -ATTTGGTCGTATTGGGCGCCTGGT-CACC-3 0 and reverse: 5 0 -GAAGATGGTGATGGGATTTC-3 0 . The amplification steps were as follows: 27 cycles of 94 8C for 30 s, 56 8C for 30 s, and 72 8C for 30 s, followed by 7 min at 72 8C. For each RT-PCR, 10 ml of product was analyzed by agarose gel electrophoresis. Bands were stained with ethidium bromide, and the band intensity was quantified using a gel documentation system (Gene Genius; Syngene, Cambridge, UK).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!