The extraction, purification and identification of RNA were applied all according to our previous studies 20 (link),21 (link). The A260/A280 ratio of purified RNA was typically between 1.8 and 2.4 and the yield between 80µg and 120µg. RNA samples were stored at -80°C. RNA integrity was assessed by gel electrophoresis. RNase R was used to eliminate the linear RNAs. One Step SYBR RT-PCR Kit (Takara, Dalian, Liaoning, China) was used to qualify the expression level of circHIPK3 according to manufacturer's instructions using a 7700 PCR System (Applied Biosystems, ThermoFisher, Foster City, CA, USA). Each reaction contained 2×One Step SYBR RT-PCR Buffer (12.5 µL), PrimeScript 1 Step Enzyme Mix 2 (1 µL), Forward Primer (10µM, 1 µL), Reverse Primer (10µM, 1.25 µL), RNA template (2 µL) and RNase Free dH2O (7.5 µL). The cycling condition is as follows: Stage 1: 42℃ for 5 min, 95℃ for 10 sec,1 Cycle; Stage 2: 95℃ for 5 sec, 60℃ for 30 sec, 40 Cycles; Stage 3: 95℃ for 15 sec, 60℃ for 30 sec, 95℃ for 15 sec, 1 Cycles. The primers for circHIPK3 were 5'- TTCAACATATCTACAATCTCGGT -3' (sense) and 5'- ACCATTCACATAGGTCCGT -3' (antisense) 19 (link). After normalization with reference to expression of GAPDH, the relative expression level of circHIPK3 was calculated as 2-ΔΔCT method.
7700 pcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The 7700 PCR System is a real-time PCR instrument designed for accurate and reliable nucleic acid amplification and detection. It provides a platform for a variety of real-time PCR applications, including gene expression analysis, pathogen detection, and SNP genotyping. The system features a high-performance optical system, thermal cycling capabilities, and intuitive software, enabling efficient and reproducible results.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using 7700 pcr system
1
Quantification of circHIPK3 Expression
2
Quantitative RT-PCR Analysis of Kidney Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from Han:SPRD rat kidney tissue (100 mg, stored temporarily in liquid nitrogen) using 1 ml TRIzol Õ (Life Technologies, Carlsbad, CA, USA), then (1 mg) reverse transcribed in a 10 ml reaction mix (2 mg RNA, 1 ml oligo(dT), 1 ml dNTP mix, 6 ml RNase free double distilled water. Real-time fluorescent quantitative polymerase chain reaction (PCR) was performed using a 7700 PCR system (Applied Biosystems, Carlsbad, CA, USA) in a 25-ml reaction mix comprising 12.5 ml of 2 Â Premix Ex Taq, 1 ml each primer, 1 ml cDNA, and 9.5 ml double distilled water). The cycling programme involved preliminary denaturation at 95 C for 10 min, followed by 40 cycles of denaturation at 95 C for 10 s, annealing at 60 C for 30 s, and elongation at 72 C for 20 s. Primer sequences were NHERF1: sense 5 0 -GGATTTGGTCGTA TTGGG-3 0 and antisense 5 0 -GGATGGA AGATGGTGGAT-3 0 ; b-catenin sense 5 0 -GGATTTGGTCGTATTGGG-3 0 and antisense 5 0 -GGATGATGAAGAGGGATG-3 0 ; GAPDH sense 5 0 -AAGGTGGTGAAG CAGGCGGC-3 0 and antisense 5 0 -GAGCA ATGC CAGCCCCAGCA-3 0 . The ratio of target to reference gene (GAPDH) was calculated based on the fluorescence curve and C T value. 12
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!