Onegreen fast qpcr premix

Total RNA was prepared using RNeasy kit (Qiagen 74106) according to the supplier’s instruction. 1 µg of RNA was retro-transcribed using high-capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, 4368813) containing Multi-Scribe Reverse Transcriptase according to the supplier’s instruction. Quantitative real-time PCR was performed using OneGreen FAST qPCR premix (Ozyme, OZYA008) on a StepOne Real-time PCR System (Thermofisher Scientific). All samples were analyzed in duplicates. Data were normalized relative to HPRT mRNA levels. The list of primers is the following: THSB2: F—AGAGTCACTTCAGGGGTTTGC; R—TGGCAACCCTTCTTGCTTAGA, CCBE1: F—ACATGGTGAAAGCCGGAACT; R—TTGTTGGGGAGCAGAGCAAT, E2F8: F—CATGCTCGAGGACAGTGGTT; R—GCACTGCGTGAGAGGGATTA, APLN: F—GTTTGTGGAGTGCCACTG; R—CGAAGTTCTGGGCTTCAC, ADAMTS3: F—TTCCAGGAACCTCTGTTGCC; R—GCTGATCTCTTGTAGACAAC, FBN: F—ACCTCA ACAGATGGCTCTCG, R—GCAGCACTGCATTTT CGTCA, COL1A1: F—TGATGGGATTCCCTGGACCT; R-CCAGCCTCTCCATCTTTGC, HPRT: F—TGGCCATCTGCCTAGTAAAGC; R— GGACGCAGCAACTGACATTTC, E2F1: F—AGGAACCGCCGCCGTTGTTCCCGT; R—CTGCCTGCAAAGTCCCGGCCACTT, Leptin: F—GCTGTGCCCATCCAAAAAGTCC; R—CCCAGGAATGAAGTCCAAACCG, Adiponectin: F—GTGAGAAAGGAGATCCAGGTCTT; R—TTTCCTGCCTTGGATTCCCG.

RNA was extracted using the Arcturus^® PicoPure^® RNA Isolation Kit (Applied Biosystems^TM by Life technologies^TM) according to the manufacturer’s instructions. Reverse transcription was performed using OneScript^® RT Mix for qPCR w/gDNAOut (Ozyme), followed by amplification using ONEGreen^® FAST qPCR Premix (Ozyme) according to the manufacturer’s instructions. Primers (IL-10, IL-23, IL-12a, TNF-α, TGF-β, and GusB) were purchased from Bio-Rad. Quantitative PCR was performed on QuantStudio 5 Dx (Applied Biosystems by Thermo Fisher Scientific). All CTs were collected, and ∆CT was calculated by subtracting to GusB (housekeeping gene) CT. The relative expression to GusB for each gene was calculated by using the formula RE = 2^−ΔΔCT.

At 48 h after transduction (CRISPRi) or transfection (CRISPRa), cells were collected by using trypsin (Lonza, Basel, Switzerland), and RNA was extracted with RNeasy Plus Mini Kit (QIAGEN, Hilden, Germany). RNA was reverse-transcribed in cDNA using the SuperScript IV First-Strand Synthesis System (Thermofisher, Waltham, Massachusetts, USA). Quantitative PCR was performed in triplicate using ONEGreen^® FAST QPCR PREMIX (Ozyme) in the Light Cycler 480 (Roche). Primer sequences for GJB2 were forward primer 5′-TTCCTCCCGACGCAGAGCAA and reverse primer 5′-TCCTTTGCAGCCACAACGAGGAT, and for beta-actin, forward primer 5′-GTTGCTATCCAGGCTGTG and reverse primer 5′-CACTGTGTTGGCGTACAG.