Cd303 pe cy7

2 x 10⁶ cells were resuspended in 1 mg/mL beriglobin in PBA-E, incubated for 5 min and subsequently stained according to manufacturers recommendation with following antibodies in PBA-E in darkness at 4°C for 20 min. Set 1: CD45 V500 (clone HI30, BD Biosciences), CD15 BV605 (clone W6D3, BD Biosciences), CD14 FITC (clone M5E2, BD Biosciences), CD163 PE (clone GHI/61, BD Biosciences), CD32b PE/Cy7 (clone FUN-2, Biolegend), CD16 PerCP-Cy5.5 (clone 3G8, BD Biosciences), CD206 Alexa Fluor 700 (clone 15-2, Biolegend) and CD64 APC-H7 (clone 10.1, BD Biosciences); Set 2: CD45 V500 (clone HI30, BD Biosciences), FceRI BV605 (clone AER-37 (CRA1), BD Biosciences), CD141 FITC (clone JAA17, ThermoFisher (eBioscience)), CD303 PE/Cy7 (clone 201A, Biolegend), CD1c PerCP-Cy5.5 (clone F10/21A3, BD Biosciences), CD11c APC (clone N418, Biolegend), HLA-DR Alexa Fluor 700 (clone G46-6 (L243), BD Biosciences), CD117 APC/Cy7 (clone 104D2, Biolegend). Cells were washed with PBA-E and analysed on a FACS Canto-Plus flow cytometer (Becton Dickinson). Prior analysis, 1 µg/mL DAPI (4′,6-diamidino-2-phenylindole, Cell Signaling Technology) was added to each sample. Data were analysed with FlowJo V10.7 (BD).

RNA Aptamer Apt 21-2 (25 (link)) was synthesized to order by Dharmacon GE Healthcare as 33 nucleotides (5′ GGUCUAGCCGGAGGAGUCAGUAAUCGGUAGACC 3′) with 2′ fluoro-modified cytosine and uracil. A fluorescently tagged Apt 21-2 was also synthesized by addition of a single Cy3 molecule on the 5′ end of the aptamer (Apt 21-2 Cy3) (24 (link)). Fluorochrome-conjugated antibodies were obtained from Miltenyi Biotech (HLA-DR-FITC, CD11c-VioBlue, CD14-VioBlue, CD19-VioBlue, IFNα-APC) or BioLegend (CD303-PE-Cy7, CD123-BV711). For analysis of intracellular cytokines by flow cytometry, cytokine secretion was inhibited by GolgiPlug (BD Biosciences).