Live dead viability cytotoxicity kit

Manufactured by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, China, Spain, France, Japan, Sweden, Canada

The LIVE/DEAD Viability/Cytotoxicity Kit is a fluorescence-based assay used to simultaneously identify live and dead cells in a sample. The kit contains two fluorescent dyes: one that stains live cells and another that stains dead cells. This allows for the quantification of the relative number of live and dead cells in a population.

Automatically generated - may contain errors

Lab products found in correlation

873 protocols using live dead viability cytotoxicity kit

Evaluating hADSCs Viability on Scaffolds

Check if the same lab product or an alternative is used in the 5 most similar protocols

To observe the viability of the hADSCs on the substrates, the cells were stained with the LIVE/DEAD viability/cytotoxicity kit (Invitrogen) after they were cultured in the scaffolds for 1, 3 and 5 days, and the cell viability was observed under a fluorescence microscope (Nikon Eclipse E-600 FN). To further evaluate the biocompatibility of the scaffolds, the hADSCs were cultured on the scaffolds for 3 days and stained with the LIVE/DEAD viability/cytotoxicity kit (Invitrogen), then fixed with 4% PFA and counterstained with Hoechst (Invitrogen). The scaffolds were scanned layer by layer using confocal microscopy (Leica SP5), and the reconstructed 3D scaffolds were imaged at 0, 45 and 90 degrees.

Yu Z., Xiao C., Huang Y., Chen M., Wei W., Yang X., Zhou H., Bi X., Lu L., Ruan J, & Fan X. (2018). Enhanced bioactivity and osteoinductivity of carboxymethyl chitosan/nanohydroxyapatite/graphene oxide nanocomposites. RSC Advances, 8(32), 17860-17877.

+ Open protocol

+ Expand

Evaluating Osteoblast Viability on Titanium

Check if the same lab product or an alternative is used in the 5 most similar protocols

A Live/Dead Viability/Cytotoxicity kit (Invitrogen, Carlsbad, CA, United States) was used to qualitatively detect the viability of OBs on the Ti–M–H sample. The OBs were seeded on the surface of the sample for 1, 3, and 5 days. At each time point, the sample was washed three times with PBS, followed by addition of 50 μl working solution (Live/Dead Viability/Cytotoxicity kit, Invitrogen). After incubation in the dark for 1 h, the sample was rinsed gently with PBS, and live cells stained in green and dead cells stained in red were visualized via CLSM.

Wang X., Mei L., Jiang X., Jin M., Xu Y., Li J., Li X., Meng Z., Zhu J, & Wu F. (2021). Hydroxyapatite-Coated Titanium by Micro-Arc Oxidation and Steam–Hydrothermal Treatment Promotes Osseointegration. Frontiers in Bioengineering and Biotechnology, 9, 625877.

+ Open protocol

+ Expand

Evaluating Cell Viability in THP-1 and U937 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

THP-1 (2 × 10⁵ cells/ml) or U937 (2 × 10⁵ cells/ml) cells were seeded into a 4-chamber slide (Nunc™ Lab-Tek™ II Chamber Slide™ System, Thermo–Fisher Scientific, USA) at 1 ml/well. After seeding, the culture medium was treated with 30-μg/ml DD for 24 h at 1 ml/well. The cells were washed with Dulbecco’s phosphate-buffered saline, then loaded with calcein-AM (LIVE/DEAD^® Viability/Cytotoxicity Kit, Thermo–Fisher Scientific, USA) and ethidium homodimer-1 (LIVE/DEAD^® Viability/Cytotoxicity Kit, Thermo–Fisher Scientific, USA) for 30 min, and added to each slide, according to the manufacturer’s protocol. Images were obtained using confocal microscopy FV10i (OLYMPUS Fluoview USA) (green: live cells; red: dead cells; scale bar = 100 μm).

Park M.N., Jeon H.W., Rahman M.A., Park S.S., Jeong S.Y., Kim K.H., Kim S.H., Kim W, & Kim B. (2022). Daemonorops draco Blume Induces Apoptosis Against Acute Myeloid Leukemia Cells via Regulation of the miR-216b/c-Jun. Frontiers in Oncology, 12, 808174.

+ Open protocol

+ Expand

Endometrial Cell Viability Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Endometrial cell viability was evaluated using a LiveDead Viability/Cytotoxicity kit (Life Technologies) according to manufacturer’s instructions. Briefly, 3-D endometrial cell structures were washed with PBS, incubated with 2 μM calcein AM and 4 μM Ethidium homodimer-1 (EthD-1) in PBS for 45 minutes at room temperature in the dark, washed twice, mounted directly in the dish under coverslips with Vectashield (Vector Laboratories), sealed with nail polish, and observed at 518 nm and 593 nm with an Olympus BX41 microscope equipped with epifluorescence. Three photos were taken per dish at 200X magnification. The percentage of live cells were calculated by dividing the number of live cells by the total number of cells counted with the Multi-point tool in ImageJ (National Institutes of Health).

Dundon M., Madden O, & Comizzoli P. (2019). Three-dimensional culture of endometrial cells from domestic cats: A new in vitro platform for assessing plastic toxicity. PLoS ONE, 14(5), e0217365.

+ Open protocol

+ Expand

Synthesis and Characterization of Multifunctional Nanoparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols

Gold chloride trihydrate (HAuCl₄·3H₂O, 48%), sodium borohydride (NaBH₄, 98%), silver nitrate (AgNO₃, 99%), L-ascorbic acid (99%), hexadecyltrimethylammonium bromide (CTAB, 98%), cetyltrimethylammonium (CTAC solution 25% in water), trisodium citrate (99%), ammonia solution, minocycline (MINO), and Ingacure 2959 were obtained from Sigma-Aldrich. Hydrogen peroxide solution (30 wt%), tetraethyloxysilane (TEOS), and GelMA were purchased from Aladdin Reagent Co. Ltd. Sodium hydroxide (NaOH), and methanol (CH₃OH) were purchased from Sinopharm Chemical Reagent Limited Corporation and used as received. Trypsin-EDTA (0.25%), fetal bovine serum (FBS), Dulbecco’s modified Eagle medium (DMEM), Hank’s Balanced Salt Solution, LIVE/DEAD™ Viability/Cytotoxicity Kit, LIVE/DEAD^TM BacLight^TM Bacterial Viability Kit and 5-diphenyl-2-H-tetrazolium bromide (MTT) were purchased from Life Technologies. Brain Heart Infusion (BHI), hemin and vitamin K were purchased from the Solarbio. Water was purified with a Millipore system, and all glassware and Teflon-coated magnetic stirring bars were thoroughly cleaned with aqua regia, followed by copious rinsing with purified water.

Lin J., He Z., Liu F., Feng J., Huang C., Sun X, & Deng H. (2020). Hybrid Hydrogels for Synergistic Periodontal Antibacterial Treatment with Sustained Drug Release and NIR-Responsive Photothermal Effect. International Journal of Nanomedicine, 15, 5377-5387.

+ Open protocol

+ Expand

Evaluation of Afobazole's Cytoprotective Effects

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following compounds and reagents were used in this investigation: DTG (Tocris Biosciences, Ellisville, MO, United States); Live/Dead Viability/Cytotoxicity Kit (Life Technologies); Sodium Azide (ACROS Organics, Fair Lawn, NJ, United States); Fura-2AM (Molecular Probes, Eugene, OR, United States). The following antibodies were also used: Alexa Fluor 488 anti-mouse IgG (A-11001) and anti-rabbit IgG (A-11008) (Life Technologies); anti-Bax (ab5714), anti-activated caspase-3 (ab32351) and anti-Bcl-2 (ab32370) (Abcam, Cambridge, MA, United States). Afobazole was generously provided by IBC Generium (Moscow, Russia). The vehicle for drugs and reagents used were either water (H₂O), ethanol (EtOH) or dimethyl sulfoxide (DMSO), and appropriate vehicle controls were carried out for each study.

Behensky A.A., Katnik C., Yin H, & Cuevas J. (2019). Activation of Sigma Receptors With Afobazole Modulates Microglial, but Not Neuronal, Apoptotic Gene Expression in Response to Long-Term Ischemia Exposure. Frontiers in Neuroscience, 13, 414.

+ Open protocol

+ Expand

Cell Viability Quantification Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

The LIVE/DEAD Viability/Cytotoxicity Kit (Life Technologies) was used per manufacturer instructions to determine viability after cell isolation. 3 images/sample were taken with a fluorescent microscope (Olympus model IX51; Olympus America Inc, Central Valley, PA) and averaged to determine percent viability ([# live cells/ # dead cells] *100).

Aird A.L., Nevitt C.D., Christian K., Williams S.K., Hoying J.B, & LeBlanc A.J. (2015). Adipose – derived stromal vascular fraction cells isolated from old animals exhibit reduced capacity to support the formation of microvascular networks. Experimental gerontology, 63, 18-26.

+ Open protocol

+ Expand

Viability Assay of DFAT Cell Fibers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Viability assay was performed on DFAT cells in cell fibers 7 and 21 days after differentiation induction using LIVE/DEAD Viability/Cytotoxicity kit (Life Technologies, Carlsbad, CA, USA). DFAT cell fibers from both the control and differentiation induction groups were incubated in live/dead viability assay working solution (1 μM calcein AM + 1 μM ethidium homodimer-1 in PBS (+)) for 30 minutes at 37°C. DFAT cell fibers were subsequently imaged by phase contrast and fluorescence microscopy (IX71, Olympus, Tokyo, Japan).

Hsiao A.Y., Okitsu T., Onoe H., Kiyosawa M., Teramae H., Iwanaga S., Kazama T., Matsumoto T, & Takeuchi S. (2015). Smooth Muscle-Like Tissue Constructs with Circumferentially Oriented Cells Formed by the Cell Fiber Technology. PLoS ONE, 10(3), e0119010.

+ Open protocol

+ Expand

Assaying Rat Cardiac Fibroblast Viability

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primary adult rat cardiac fibroblasts were grown in Permanox plastic chamber slides (Nunc, Thermo Fisher Scientific) in DME/F12 medium (HyClone, GE Healthcare) supplemented with 0.5 % FBS and 500 μmol/L ascorbic acid. Cells were infected with AdshLacZ (control) or AdshScx adenovirus at MOI 200 for 48 h. Cell viability was assayed using the LIVE/DEAD Viability/Cytotoxicity kit as per manufacturer’s instructions (Life Technologies). Vital dyes calcein acetoxymethyl ester (calcein AM) and ethidium homodimer-1 were used to visualize live (green) and dead (red) cells, respectively, using a Zeiss Axio Imager M1 epifluorescence microscope with 10× EC Plan-Neofluar objective (NA 0.3). Data was recorded as percent cell death compared to control from three independent experiments (minimum total cell count of 400); 200 μmol/L H₂O₂-treated cells were used as dead cell control.

Bagchi R.A., Roche P., Aroutiounova N., Espira L., Abrenica B., Schweitzer R, & Czubryt M.P. (2016). The transcription factor scleraxis is a critical regulator of cardiac fibroblast phenotype. BMC Biology, 14, 21.

+ Open protocol

+ Expand

Isolating and Differentiating Primary Adipocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primary adipocytes were isolated from dissected gWAT of 12-week old mice and digested with collagenase (Sigma) in Krebs-Ringer HEPES buffer at 37°C for 1 hour. The digested tissue was filtered, and the centrifugated to obtain the supravascular (SV) fraction, which was resuspended and cultured in DMEM (Gibco) supplemented with 10% FBS and 1× P/S (Gibco). Adipogenic differentiation was induced by supplementing the tissue culture medium with 250 μM IBMX, 0.1 μM dexamethasone and 0.5 μg/ml insulin for 4 days. After this period, the culture medium was supplemented with insulin only.
Knockdown of FTO or RUNX1T1 in cell lines was achieved using Lipofectamine RNAiMAX (Invitrogen, California, USA) using siRNA directed against mouse FTO (CCUGCGAUGAUGAAGUGGACCUUAA (Invitrogen, California, USA)), mouse RUNX1T1 (#161027, Invitrogen, California, USA) and stealth RNAi siRNA Negative Control Medium GC (Invitrogen, California, USA) as a control. To overexpress FTO, cells were transfected using Lipofectamine2000 (Invitrogen, California, USA) with either a pcDNA3.1 vector containing full-length mouse FTO cDNA, R313A full-length mouse FTO cDNA or an empty pcDNA3 vector as a control. Cell viability after transfection was assessed using the LIVE/DEAD viability/cytotoxicity kit (Life technologies).

Merkestein M., Laber S., McMurray F., Andrew D., Sachse G., Sanderson J., Li M., Usher S., Sellayah D., Ashcroft F.M, & Cox R.D. (2015). FTO influences adipogenesis by regulating mitotic clonal expansion. Nature Communications, 6, 6792.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!