The largest database of trusted experimental protocols

218 protocols using sc 2027

1

Mapping lncRNA-Protein Interactions

Check if the same lab product or an alternative is used in the 5 most similar protocols
To test the interaction between the lncRNAs and either AKT or WDR26, 1 × 107 CA1D were transfected with siRNAs for WDR26 or with the non-targeting siRNA as a negative control. In all, 48 h after the transfection, the cells were incubated overnight with 100 µM 4-thiouridine to allow for the UV-driven crosslinking between RNAs and interacting proteins. The cells were then lysed in 20 mM Tris–HCl at pH 7.5, 100 mM KCl, 5 mM MgCl2, and 0.5% NP-4050 (link),51 (link) and the proteins of interest were immunoprecipitated using 1 µg of each of the following primary antibodies: AKT (9272 S, Cell Signaling), WDR26 (ab203345, Abcam), and normal rabbit IgG (sc-2027, Santa Cruz) as negative control. The presence of the lncRNAs in the CLIP-ed samples was assessed via qRT-PCR using the Taqman probes listed in Supplementary Table 1. To map the regions of TROLL-2 and TROLL-3 interacting with WDR26, 1 × 107 CA1D were utilized. The CLIP assay was performed as above and including an RNAse T1 treatment step (1 U/µL at 22 C for 10 min)50 (link),51 (link) and using 1 µg of each of the following primary antibodies: WDR26 (ab203345, Abcam) and normal rabbit IgG (sc-2027, Santa Cruz) as negative control. The presence of the lncRNA fragments in the CLIP-ed samples was assessed via qRT-PCR using the primers listed in Supplementary Table 5.
+ Open protocol
+ Expand
2

Antibody validation for Western blot and co-IP

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antibodies used for Western blots were as follows: anti-Trim28 20C1 (ab22553, Abcam), anti-YY1 C-20 (sc281, Santa Cruz Biotechnology), anti-HA.11 (901515, BioLegend), anti-myc 71D10 (2278, Cell Signaling Technology), anti-myc 9E10 (sc-40, Santa Cruz Biotechnology), anti-Flag M2 (F3165, Sigma-Aldrich), pS824-Trim28 (ab70369), anti-Oct3/4 (H-134, Santa Cruz Biotechnology), and anti-β-actin (A1978, Sigma). Antibodies used for co-IP experiments are as follows: anti-YY1 C-20 (sc281, Santa Cruz Biotechnology), rabbit control antibody (sc-2027, Santa Cruz Biotechnology). Antibodies used for EMSA shifts were as follows: anti-YY1 C-20 (sc281, Santa Cruz Biotechnology), anti-Trim28 20C1 (ab22553, Abcam), and rabbit control antibody (sc-2027, Santa Cruz Biotechnology).
+ Open protocol
+ Expand
3

Antibody Panel for Molecular Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The Abs used for immunoblotting were rabbit anti-PYCARD Ab (13833, Cell Signaling), mouse anti-actin Ab (sc-130301, Santa Cruz Biotechnology), mouse anti-DNMT1 Ab (ab13537, Abcam) and goat anti-G9a Ab (sc-22879, Santa Cruz Biotechnology). The Abs used for IP analysis were mouse anti-DNMT1 Ab (ab13537, Abcam) and normal mouse IgG (sc-2025, Santa Cruz Biotechnology). The Abs used for ChIP analysis were rabbit anti-H3K9me2 Ab (4658, Cell Signaling), rabbit anti-H3K27me3 Ab(9733, Cell Signaling), rabbit anti-RNA polymerase II CTD repeat YSPTSPS (S5P Pol II) Ab (ab5131, Abcam), rabbit anti-RNA polymerase II CTD repeat YSPTSPS (S2P Pol II) Ab (ab5095, Abcam), mouse anti-RNA pol II Ab (39097, Active Motif), mouse anti-DNMT1 Ab (ab13537, Abcam), rabbit anti-G9a Ab (ab40542, Abcam), normal mouse IgG (sc-2025, Santa Cruz Biotechnology) and normal rabbit IgG (sc-2027, Santa Cruz Biotechnology). The Abs used for RIP analysis were mouse anti-DNMT1 Ab (ab13537, Abcam), rabbit anti-G9a Ab (ab40542, Abcam), mouse anti-p53 Ab (P6874, Sigma-Aldrich), rabbit anti-RPS6 Ab (ab70227, Abcam), rabbit anti-L26 Ab (ab59567, Abcam), normal mouse IgG (sc-2025, Santa Cruz Biotechnology) and normal rabbit IgG (sc-2027, Santa Cruz Biotechnology). The Ab used for nuclear run-on assay was anti-BrdU Ab (ab1893, Abcam).
+ Open protocol
+ Expand
4

Chromatin Immunoprecipitation Assay for miR-183 Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The ChIP assay was conducted as previously reported [16 (link)]. In short, the cultured microglial cells were washed twice with precooled PBS and added with 1% paraformaldehyde for 5 min of crosslinking at room temperature, which was halted with 127 mM glycine. The cells were then lysed in the ChIP-grade cell lysis buffer containing 50 mM Tris HCl (pH 8.1), 1% SDS, 10 mM ethylenediaminetetraacetic acid (EDTA), and complete protease inhibitor mixture (Roche Diagnostics GmbH, Mannheim, Germany) on ice for 30 min. Then, the cells were subjected to ultrasonic treatment to make the DNA fragments (200–1000 bp). The subsequent ChIP assay was conducted using the ChIP Assay Kit (Millipore). Briefly, 1 μg DNA was added with protein A agarose and ChIP-grade anti-ac-H4 (ab15823, Abcam) or anti-HDAC2 (sc-81599, Santa Cruz Biotechnology) for incubation overnight 4 °C. Normal mouse antibody to IgG (sc-2025, Santa Cruz Biotechnology) or normal rabbit antibody to IgG (sc-2027, Santa Cruz Biotechnology) served as NC. The next day, the DNA complex was washed with low-salt and high-salt buffer and treated with protease K at 56 °C for 2 h, after which the DNA was extracted and purified by phenol/chloroform. The primers for specific ChIP-qPCR amplification of miR-183 promoter region were F: 5′-CGTAGGGCCACTGGACGA-3’ and R: 5′-TTGTCCCCATTCCAGCCCTG-3′.
+ Open protocol
+ Expand
5

Chromatin Immunoprecipitation of Mouse Aortic Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols
Freshly isolated mouse aortas were carefully stripped out of the adventitial layer and chopped into small pieces. Aortic tissue was digested with 0.05% trypsin-EDTA (BRL 25300; Gibco) for 5 min at 37°C, followed by the addition of 9 ml of 10% FBS-DMEM to stop digestion. ChIP assays were performed using aortic tissues as previously described (Wang et al., 2008 (link)). The antibodies used in ChIP included anti-H3 (ab1791; Abcam), H3K9ac (ab10812; Abcam), H4 (05-858; EMD Millipore), H4K16ac (07-329; EMD Millipore), SIRT1 (07-131; EMD Millipore), and normal rabbit IgG (sc-2027; Santa Cruz Biotechnology, Inc.). DNA was detected by quantitative real-time PCR. Specific primers were designed to amplify the Mmp2 promoter. The primer sequences are provided in Table S3.
+ Open protocol
+ Expand
6

Chromatin Immunoprecipitation for CEBPD

Check if the same lab product or an alternative is used in the 5 most similar protocols
In brief, cells were treated with 1% formaldehyde for 10 min, and the nuclear proteins were extracted. The cross-linked chromatin was then prepared and sonicated to an average length between 200 bp and 1000 bp. The DNA fragments were immunoprecipitated with specific antibodies recognizing CEBPD (sc-636x, Santa Cruz, CA, USA) or control rabbit immunoglobulin G (IgG) (sc-2027, Santa Cruz, CA, USA) at 4 °C for 16 h. After reversal of the crosslinking between proteins and genomic DNA, the precipitated DNA was amplified by PCR with primers related to the specific regions on the genomic loci of target genes. The following primers were used: PDGFA-I forward 5′-GACTCCCCCTCCTTTTATGG-3′ and PDGFA-I reverse 5′-AGTGCCAGCTGCAATCCT-3′, and PDGFA-II forward 5′-GGGGCTTTGATGGATTTAGC-3′ and PDGFA-II reverse 5′-GGCGGGGAGAGGGTTATAG-3′.
+ Open protocol
+ Expand
7

Transcription Factor Binding Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were cross-linked with 1% formaldehyde and processed by following the protocol of Upstate Biotechnology. Anti-IgG (sc-2027, Santa Cruz), anti-SMAD4 (EP618Y, Abcam), and anti-SKI (H-329, Santa Cruz) were used for immunoprecipitation. Quantitative RT-PCR was performed to detect the binding at Rorc promoter region. The primers sequences were: GGGGAGAGCTTTGTGCAGAT and AGTAGGGTAGCCCAGGACAG.
+ Open protocol
+ Expand
8

Antibody Panel for NF-κB Pathway Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antibodies targeting USP16 (B-3; 1:500), IKKα (B-8; 1:1000), IKKγ (B-3; 1:1000), IκBα (C-21; 1:1000), p65 (C-20; 1:1000), Lamin B (C-20; 1:1000), ERK (K-23; 1:2000), phospho-ERK (E-4; 1:1000), JNK2 (C-17; 1:1000), p38 (H-147; 1:1000), ubiquitin (P4D1; 1:1000), p105/p50 (E-10; 1:1000), and c-Rel (sc-71; 1:1000), as well as a control rabbit IgG (sc-2027), were purchased from Santa Cruz Biotechnology. Antibodies targeting IKKβ (L570; 1:1000), phospho-IκBα (S32; 9241; 1:1000), phospho-JNK (T180/Y185; 9251; 1:1000), phospho-p38 (T180/Y182; 9211; 1:1000), phospho-IKKα/β (S176/180, 16A6), and phospho-p105 (S933; 18E6; 1:1000) were purchased from Cell Signaling Technology. Anti-actin (C-4; 1:10,000), anti-HA (12CA5), anti-FLAG (M2), horseradish peroxidase (HRP)–conjugated anti-HA (3F10), and anti-FLAG (M2) were purchased from Sigma-Aldrich. Anti-CD40-PE (phycoerythrin) (1C10), anti-CD80-APC (allophycocyanin) (16-10A1), and anti-CD86-FITC (fluorescein isothiocyanate) (GL1) for costimulatory molecular analysis were purchased from eBioscience. Fluorescence-labeled antibodies are listed in the section describing the flow cytometry and cell sorting procedures.
LPS (derived from Escherichia coli strain 0127: B8) and CpG (2216) were purchased from Sigma-Aldrich. R848 and polyI:C were purchased from Amersham, and recombinant murine M-CSF was purchased from Peprotech.
+ Open protocol
+ Expand
9

Immunoprecipitation of HSF1 and HSF2

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were rinsed twice with cold PBS, removed from plates by scraping, and centrifuged for 4 min at 1000g and 4°C before pellet resuspension in cold lysis buffer. For IPs of HSF1 or HSF2, cells were lysed in buffer containing 1% NP-40, 100 mM NaCl, 50 mM tris (pH 7.5), 0.2 mM EDTA, 5% glycerol, and 1 mM phenylmethylsulfonyl fluoride (PMSF), and lysis was achieved by sonication in a 4°C water bath (10 cycles of 30-s on and 1-min off). After lysis, cells were spun at 21,000g at 4°C for 10 min, and the supernatant was kept for input and IP. FLAG-IPs were performed using M2 affinity agarose (Thermo Fisher Scientific). HSF1 IP was performed with a polyclonal rabbit anti-HSF1 antibody (Cell Signaling Technology, #4356S). HSF2 IP was performed with a monoclonal rat anti-HSF2 (3E2) antibody (Santa Cruz Biotechnology, sc-13517). As a control for nonspecific binding, normal mouse IgG was immunoprecipitated (Santa Cruz Biotechnology, sc-2027).
+ Open protocol
+ Expand
10

Co-immunoprecipitation of EZH2 and E2F1

Check if the same lab product or an alternative is used in the 5 most similar protocols
The co-IP experiments of endogenous EZH2 and E2F1 proteins were performed in abl cells as describe previously (9 (link)). Antibodies used for the co-IP assays include 6 ug of E2F1 (sc-193; Santa Cruz Biotechnology), 8 uL of EZH2 (39933, Active Motif), and equal amount of normal rabbit IgG (sc-2027; Santa Cruz Biotechnology).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!